Informazione

Quanta variazione c'è tra le molecole di DNA dello stesso organismo?

Quanta variazione c'è tra le molecole di DNA dello stesso organismo?


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Se dal mio corpo venissero estratte molecole di DNA diverse ma intatte, ad esempio campione di capelli, campione di sangue e tampone orale, quanta variazione ci sarebbe tra le molecole di DNA?


Il fenomeno si chiama variazioni del singolo nucleotide a mosaico (SNV) nelle cellule somatiche ed è un'area attiva di ricerca scientifica (ad esempio, Abyzov et al., 2017, Genome Res. 27: 512-523):

Stimiamo che in media una cellula di fibroblasti nei bambini abbia 1035 SNV a mosaico per lo più benigni.

Analisi simili negli adulti non hanno rivelato un aumento significativo del numero di SNV per cellula, suggerendo che una frazione importante di SNV a mosaico nei fibroblasti si verifica durante lo sviluppo.


Ci sono diverse risposte a questa domanda, a seconda di cosa intendi esattamente.

Le cellule del corpo accumuleranno mutazioni casuali mentre si dividono e si moltiplicano

Le cellule del corpo che non fanno parte della linea riproduttiva sono chiamate "cellule somatiche". Queste cellule sono tipicamente derivate da un singolo uovo fecondato. Ogni volta che la cellula si divide, il DNA deve essere duplicato e ogni volta che viene duplicato c'è la possibilità che si verifichi una mutazione casuale. Queste mutazioni casuali verranno trasmesse a tutte le cellule che verranno successivamente derivate da questa cellula. La maggior parte del lavoro in quest'area riguarda le variazioni di un singolo nucleotide (vedi la risposta di Martin Klvana) ma possono esserci anche inserzioni, delezioni e duplicazioni come con altre mutazioni.

I danni da radiazioni e altri agenti mutageni possono causare mutazioni del DNA

Le cellule sono soggette a danni per tutta la loro vita e alcune forme di danno provocano rotture o alterazioni del DNA della cellula. Esistono complessi meccanismi di riparazione in atto per affrontare questo danno, ma sono imperfetti, quindi nel tempo questo danno può comportare differenze nella sequenza del DNA delle cellule del corpo. Questo aumenterà con l'età.

Alcune cellule hanno meccanismi di mutazione intenzionale e casuale

Alcune cellule del corpo si sono evolute per essere casualmente diverse l'una dall'altra. L'esempio più ovvio di ciò è nel sistema immunitario, dove vengono utilizzati riarrangiamenti casuali di sezioni specifiche di DNA per creare una vasta gamma di anticorpi diversi.

Gli elementi genetici mobili possono attivarsi e riorganizzarsi attraverso il corpo

Il genoma umano, come quello di altri organismi, è pieno di trasposoni e altri elementi genetici che contengono macchinari genetici per ricollocarsi all'interno del genoma. L'attività di questi elementi nelle cellule somatiche del corpo può portare a differenze nella sequenza del DNA.

Non tutti hanno tutte le cellule di un singolo uovo fecondato

Può succedere che una persona, anziché derivare da un singolo uovo fecondato, derivi da due o più ovuli fecondati, per cui il suo corpo è costituito da cellule di origine genetica distinta che sono effettivamente sorelle tra loro. Ciò può comportare grandi differenze genetiche tra le cellule.

Inoltre, nelle donne che hanno avuto figli, è comune (rilevato in circa il 50-75% delle donne) che alcune cellule del feto entrino nel corpo della madre e si stabiliscano permanentemente in un fenomeno chiamato microchimerismo fetomaterno. Ancora una volta questo può portare a grandi differenze genetiche tra le cellule.

Le differenze nel DNA vanno ben oltre le semplici differenze nella sequenza

Tutti i meccanismi che ho discusso finora porteranno a differenze nella sequenza del DNA, tuttavia il DNA in una cellula è più di un semplice deposito di informazioni sulla sequenza e la sua funzione è mediata sia da modificazioni chimiche, in particolare la metilazione del DNA, sia dall'interazione con proteine, in particolare attraverso gli istoni che mediano il ripiegamento del DNA nella cellula, o attraverso l'inattivazione selettiva di un cromosoma X nel corpo di Barr se sei femmina. Queste modifiche hanno effetti profondi sull'attività del DNA all'interno della cellula e non dovrebbero essere ignorate.

Tutto ciò significa che non esiste una risposta univoca alla tua domanda poiché cambia con il tempo, varia da persona a persona e dipende esattamente da cosa intendi.


La base della variazione ereditabile

Il modo in cui gli organismi si riproducono "secondo la loro specie" (per prendere in prestito il linguaggio dalla Genesi) è una questione di vecchia data in biologia. Una domanda strettamente correlata nasce dall'osservazione che all'interno di un "tipo", non tutti gli individui sono uguali: esiste una variazione all'interno di popolazioni della stessa specie. Per molti anni, il meccanismo che potrebbe spiegare sia l'osservatocostanza di una specie (riproduzione fedele della forma di un organismo) e variazione (non tutti i membri di una specie sono identici) è rimasto un mistero. Per fare luce su queste importanti questioni per la biologia evoluzionistica, dobbiamo dedicare un po' di tempo per esplorare i "dadi e bulloni" di come funzionano due importanti molecole biologiche e come si relazionano l'una con l'altra: l'acido desossiribonucleico (DNA) e proteine.

Genetica molecolare 101: proteine ​​e DNA

Potresti essere sorpreso di apprendere che i primi lavori nell'esplorazione delle basi molecolari della genetica hanno favorito le proteine ​​come molecola ereditaria invece del DNA. Si sospettava che qualunque cosa agisse come una molecola ereditaria sarebbe stata grande e complessa, e le proteine ​​erano entrambe le cose. Le proteine ​​possono essere molto lunghe, poiché sono a polimero di componenti più piccoli e ripetuti (monomeri). Possiamo usare i mattoncini ad incastro dei bambini per illustrare cosa intendiamo. Per i mattoni, ogni singolo pezzo è un monomero, e quando vengono agganciati insieme, formano un polimero:

Le proteine ​​sono costruite più o meno allo stesso modo. Per le proteine, i monomeri sono un gruppo di composti chiamati amminoacidi (ogni amminoacido è un monomero). Come i mattoni nella nostra analogia, hanno caratteristiche in comune che consentono loro di essere "incastrati insieme" in una lunga catena. Hanno anche differenze significative, analoghe ai diversi colori nel diagramma: alcuni amminoacidi sono idrofobici (cioè sono respinti dall'acqua), altri sono idrofili (cioè attratti dall'acqua). Alcuni sono grandi e ingombranti, altri sono relativamente piccoli e così via. A differenza dei mattoni rigidi nella nostra analogia, le proteine ​​sono meravigliosamente flessibili e si ripiegano in una forma tridimensionale, come indicato dalle proprietà dei monomeri.

Esistono 20 diversi amminoacidi che vengono utilizzati per produrre proteine ​​e possono essere combinati in qualsiasi sequenza per produrre una proteina con proprietà specifiche, proprietà che derivano dalla combinazione e dall'ordine specifico degli amminoacidi e dalla forma finale che danno alla proteina. Questa diversità nei monomeri significa che ci sono molte, molte possibilità diverse per le sequenze proteiche (e quindi le forme e le funzioni): anche un polimero di soli due monomeri di lunghezza ha 400 possibili sequenze (cioè 202, o 20吐), e le proteine ​​possono essere lunghe migliaia di amminoacidi. È stata questa possibilità per la complessità su larga scala che ha suggerito che le proteine ​​potrebbero avere una "capacità di immagazzinamento" sufficiente per contenere informazioni ereditarie e trasmetterle alla generazione successiva.

A partire dalla fine degli anni '20, tuttavia, la ricerca iniziò a puntare lontano dalle proteine ​​e verso il DNA come molecola ereditaria. Il DNA, come le proteine, è un polimero formato da un insieme di monomeri (in questo caso, acidi nucleici). A differenza dei 20 monomeri presenti nelle proteine, il DNA ha solo quattro monomeri: composti abbreviati come A, C, G e T. Fu per questo motivo che inizialmente i ricercatori erano scettici sul fatto che un polimero così "semplice" potesse fungere da fonte di informazioni ereditarie.

Nonostante questo scetticismo, continuarono ad aumentare le prove che il DNA era in effetti la base fisica per le informazioni ereditarie. Una volta che questa prova ha convinto la maggior parte degli scienziati, è iniziata la corsa per capire esattamente come il DNA avesse portato a termine questo straordinario compito. Ben presto divenne chiaro che la comprensione della struttura del DNA era cruciale per comprenderne la funzione, e diversi gruppi di ricerca notoriamente gareggiarono per essere i primi a decifrarlo.

La determinazione della struttura del DNA ha effettivamente fatto luce sulla sua funzione. Sebbene abbia solo quattro monomeri, la struttura del DNA ha rivelato come può facilmente replicarsi e trasmettere informazioni: non solo il DNA è un polimero lungo, è un polimero che può specificare la propria replicazione attraverso le interazioni tra i suoi monomeri. Forse una foto aiuterebbe a spiegare. Immagina i mattoni che ora hanno "partner" da cui sono attratti. Rappresenteremo quell'attrazione, che è un tipo di legame chimico chiamato legame idrogeno, con un punto nero. I monomeri "A" e "T" sono attratti con due legami idrogeno e i monomeri "C" e "G" con tre:

Questi "accoppiamenti di attrazione" tra monomeri sono importanti: consentono a un polimero di DNA di fungere da stampo per un secondo polimero di DNA "gratuito". Immagina una sequenza di DNA come segue:

Quando viene prodotto il secondo polimero di DNA, i monomeri vengono selezionati, uno alla volta, per abbinare i loro "partner" nel primo polimero:

Questi due polimeri sono tenuti insieme dall'allineamento di molti legami idrogeno e probabilmente li conoscete come i "due filamenti" della doppia elica del DNA:

Mentre questo modello di DNA più realistico mostra i dettagli precisi della sua struttura molecolare, le caratteristiche importanti sono riassunte dal nostro semplice modello "mattone giocattolo". Il DNA è una coppia di lunghi polimeri che possono essere separati e utilizzati per creare nuove copie fedeli all'originale.

Sebbene queste caratteristiche del DNA spieghino prontamente come viene copiato fedelmente, ricorda che dobbiamo anche spiegare la variazione. La variazione, nei termini più basilari, significa che a volte c'è imperfezione nel processo di copiatura. Se il DNA è davvero la molecola ereditaria, e se la copiatura del DNA fosse accurata al 100%, allora non si verificherebbe mai alcuna variazione e tutta la progenie sarebbe geneticamente identica ai genitori. Senza variazione, la ricombinazione non avrebbe alcun effetto (poiché non ci sarebbe variazione da mescolare in nuove combinazioni).

Ci sono molti modi in cui la variazione può entrare durante il processo di copiatura del DNA e in un prossimo post ne esamineremo diversi. Un modo che considereremo ora è il semplice "disaccoppiamento" dei monomeri durante la replica. Ad una certa frequenza (molto bassa), i monomeri inappropriati vengono accoppiati insieme. La freccia nella figura seguente mostra una di queste coppie non corrispondenti, in cui un monomero rosso (G) sul filo inferiore è stato accoppiato in modo errato con un monomero giallo (T) quando è stato realizzato il filo superiore. Quando questo set viene replicato, vengono copiati entrambi i filamenti superiore e inferiore, ma ora vengono trovati i partner corretti per ciascun monomero. Il risultato sono due risultati diversi: una copia ora ha la coppia C:G originale e corretta (a sinistra) e l'altra ha una nuova variante, con una coppia A:T (a destra). Questa modifica verrà copiata fedelmente da qui in poi, poiché le copie successive non "sanno" quale fosse la sequenza originale. Il risultato è una nuova variante nella popolazione.

Prese insieme, le proprietà del DNA corrispondono a ciò che osserviamo in natura: riproduzione fedele della forma, ma non riproduzione perfetta della forma. Alla sua base, la costanza e la variazione ereditaria nelle popolazioni biologiche risalgono a come funziona il DNA.

E le proteine?

Mentre le proprietà del DNA lo rendono una grande molecola ereditaria (che tuttavia consente la variazione), il DNA stesso non è in grado di svolgere le funzioni quotidiane di cui hanno bisogno gli organismi (funzioni enzimatiche, funzioni strutturali e così via). Per queste funzioni è necessaria la vasta diversità strutturale delle proteine. Nel prossimo post di questa serie, discuteremo di come le informazioni ereditarie nel DNA vengono trasferite alla struttura e alla funzione delle proteine ​​e come la variazione nel DNA può causare variazioni a livello della proteina.

In precedenza, abbiamo discusso di come la replicazione del DNA sia facilmente facilitata dalla sua struttura, poiché una metà della doppia elica del DNA può fungere da modello per realizzare l'altra metà. Abbiamo anche discusso di come il DNA, sebbene adatto al suo ruolo ereditario, non sia affatto adatto a svolgere funzioni cellulari, ma le proteine ​​​​ricoprono questi ruoli. Con questi dettagli coperti, siamo ora pronti per discutere come le informazioni ereditarie nel DNA vengono convertite nella diversità funzionale che vediamo nelle proteine ​​e come la variazione gioca un ruolo in questo processo. Il primo passo in questa discussione richiede di esaminare come funzionano i cromosomi e i geni.

Genetica molecolare 102: cromosomi e geni

Gli esseri umani hanno 46 cromosomi in ciascuna delle loro cellule e vengono in coppia. Riceviamo uno di ogni coppia come un insieme di 23 cromosomi da ciascun genitore: gli ovuli contengono 22 cromosomi non sessuali più un cromosoma X e lo sperma contiene 22 cromosomi non sessuali più un cromosoma X o Y. Ogni cromosoma è una lunga doppia elica del DNA, con milioni di coppie di basi del DNA. I nostri cromosomi più grandi hanno circa 250 milioni di paia di basi e i nostri più piccoli circa 50 milioni. Presi insieme, il genoma umano ha circa 3 miliardi di coppie di basi del DNA in ogni set di 23 cromosomi, o un totale di circa 6 miliardi se si contano entrambi i set.

Distribuiti su queste 23 coppie di cromosomi sono geni—le unità della funzione biologica codificate nel nostro DNA. Ciò che costituisce esattamente un "gene", come tutti i buoni concetti in biologia, è "sfocato", ma per i nostri scopi definiremo un gene come una sequenza di coppie di basi del DNA del cromosoma che vengono utilizzate per creare un prodotto funzionale, non DNA. Gli esseri umani hanno circa 20.000 geni e possono essere abbastanza sparsi sui cromosomi, con molto DNA non genetico tra di loro. Se rappresentiamo un cromosoma come una linea nera continua (come è comune in molti libri di genetica), possiamo "ingrandire" per vedere le caratteristiche di uno dei suoi numerosi geni. In questo caso, questo è un gene che produce un prodotto proteico:

(Nota: il "punto" sulla linea che rappresenta il cromosoma è il centromero, una sequenza di DNA a cui si attaccano i componenti cellulari per trascinare i cromosomi durante la divisione cellulare).

Prima di tutto, possiamo vedere che le parti del gene che vengono utilizzate per specificare la sequenza di amminoacidi proteici (i riquadri blu) sono solo una parte del tutto. Altre sequenze (come quelle rappresentate dalle linee azzurre e dai riquadri rossi) sono sequenze che indirizzano alcuni tipi di cellule a produrre questa proteina e quanto ne produce. Tutte le sequenze rappresentate come scatole sono trasformate in quello che viene chiamato "RNA messaggero" o "mRNA" - una specie di versione a filamento singolo di DNA - che è lungo solo quanto la sequenza del gene e spesso separa sequenze che si intersecano le sezioni che codificano per la struttura proteica (i cosiddetti “introni”, che si possono vedere nella figura sopra). Questa "copia di lavoro" dell'mRNA del gene viene quindi utilizzata per dirigere la sintesi della proteina attraverso un processo chiamato traduzione.

Se tutto questo sembra un po' complesso, non preoccuparti: per i nostri scopi qui, è sufficiente riconoscere che i geni sono (a) una piccola sezione di una molecola di DNA molto più lunga (cioè un cromosoma), (b) hanno alcune sequenze che determinano la sequenza della proteina che codificano (cioè l'ordine dei suoi amminoacidi) e (c) altre sequenze regolatorie che non fanno parte del codice stesso della proteina, ma funzionano invece come segnali per dire alle cellule quando e dove la proteina dovrebbe essere fatto, o "espresso".

Inserisci la variazione

Con questi dettagli in mente, ora considera come la variazione a livello del DNA può influenzare la struttura dei cromosomi. Come abbiamo visto ieri, quando i cromosomi vengono copiati, possono verificarsi errori di copiatura del DNA. Non sorprende che molti tipi di eventi di mutazione possano avere un impatto anche sulla funzione dei geni e, in definitiva, sulle caratteristiche dell'organismo:

Mutazioni di coppie di basi singole: l'errato appaiamento degli acidi nucleici può portare a copie cromosomiche che differiscono dall'originale di una coppia di basi (come abbiamo visto ieri). Queste cosiddette "mutazioni puntiformi" possono verificarsi all'interno dei geni (nel DNA regolatorio o nel DNA codificante proteine) o nelle sequenze tra i geni. I cambiamenti della singola coppia di basi nel DNA che codifica le proteine ​​possono non avere alcun effetto sulla proteina (poiché ci sono spesso diverse sequenze di DNA che producono la stessa sequenza di amminoacidi, una caratteristica nota come "ridondanza" del codice genetico). Altri cambiamenti possono alterare la sequenza amminoacidica sostituendo un amminoacido con un altro, ma non hanno ancora alcun effetto sulla funzione della proteina (poiché molte funzioni proteiche possono essere svolte da sequenze proteiche leggermente diverse). Altre modifiche potrebbero ridurre o addirittura rimuovere la funzione proteica. Ancora altri cambiamenti potrebbero migliorare la funzione delle proteine, ad esempio conferendole una migliore attività enzimatica.

Sono anche possibili cambiamenti nel DNA normativo e gli effetti di questi cambiamenti possono essere similmente neutri, dannosi o benefici. La cosa interessante del DNA regolatorio è che piccoli cambiamenti possono avere effetti piuttosto grandi su dove e quando viene prodotta una proteina, e i cambiamenti che alterano i geni chiave che funzionano all'inizio dello sviluppo possono avere effetti significativi a valle sull'organismo nel suo insieme. Lo esamineremo in dettaglio nei prossimi post di questa serie.

Eliminazione eventi: a volte, tratti di DNA possono essere persi durante la replicazione cromosomica a causa di eventi di rottura e ricongiungimento. A volte le delezioni interessano solo poche paia di basi, ma in alcuni casi possono estendersi su migliaia di paia di basi. Parti di geni, o anche interi geni, possono andare perduti e i geni che fiancheggiano la delezione vengono avvicinati. Come abbiamo visto per le mutazioni puntiformi, le delezioni possono non avere alcun effetto, un effetto dannoso o addirittura un effetto benefico a seconda dell'evento specifico. Ad esempio, a volte le delezioni rimuovono le sequenze regolatorie che interrompono l'espressione genica in determinate cellule. La rimozione di questa sequenza consente al gene di essere espresso dove non era stato espresso prima, il che potrebbe essere neutro, dannoso o benefico, a seconda delle circostanze.

Eventi di duplicazione: questo è l'opposto di una delezione, in cui una porzione della sequenza di un cromosoma viene raddoppiata e finisce fianco a fianco. Per quanto riguarda le delezioni, le duplicazioni possono essere piccole o lunghe migliaia di paia di basi, abbracciando numerosi geni e allo stesso modo essere neutre, dannose o benefiche.

Un meccanismo comune che produce duplicazioni e delezioni si verifica simultaneamente durante la ricombinazione nelle cellule che portano agli ovuli o allo sperma. Potresti ricordare che "crossing over" è il termine usato per descrivere la rottura fisica e il ricongiungimento dei cromosomi per "mescolare e abbinare" le sequenze tra le coppie di cromosomi durante le divisioni cellulari che portano ai gameti (cioè la meiosi). Normalmente, i cromosomi si accoppiano per questo scambio allineando le loro sequenze (quasi identiche), seguite da una precisa rottura e ricongiungimento:

Quello che può succedere, a bassa frequenza, è che le coppie di cromosomi non allineano correttamente le loro sequenze. L'allineamento si basa sulle stesse sequenze su ciascun cromosoma che si trovano l'un l'altro e si legano l'un l'altro. Gli errori possono accadere a causa di sequenze ripetitive tra i geni, sequenze che "ingannano" i cromosomi facendogli credere di aver trovato il loro corretto allineamento di sequenza, quando in realtà ci sono due anelli di sequenza non appaiati, uno su ciascun cromosoma. Se si verifica un crossover tra questi loop, il risultato è un cromosoma con una duplicazione e l'altro con una delezione:

Naturalmente, questo elenco di tipi di mutazione non è esaustivo (ad esempio, abbiamo visto come elementi di DNA parassiti e autonomi chiamati trasposoni possono inserirsi nei cromosomi, interrompendo le funzioni o contribuendo a crearne di nuove).

Riassumendo: costanza e cambiamento

Presi insieme, questi meccanismi introducono la variazione nelle popolazioni e poiché tale variazione è nel DNA, la variazione è ereditabile. La variazione a livello cromosomico può influenzare la funzione dei geni e, in definitiva, i tratti a livello dell'organismo. I cambiamenti a livello del DNA che causano variazioni significative a livello dell'organismo sono disponibili su cui la selezione naturale può agire e abbiamo già visto alcuni esempi di mutazioni selezionate, come la duplicazione dei geni dell'amilasi nell'uomo e nei cani. Altre mutazioni, ovviamente, vengono selezionate contro e possono essere rimosse dalle popolazioni nel tempo. Le proprietà del DNA come agente sia di costanza che di cambiamento ereditabile significano che le popolazioni non sono del tutto geneticamente stabili: possono cambiare nel tempo, sebbene le caratteristiche del DNA che lo rendono un trasmettitore di informazioni ampiamente accurato assicurano che tali cambiamenti saranno probabilmente sottili quelli a livello dell'organismo.

Come vedremo nel prossimo post di questa serie, questa instabilità genetica può mettere popolazioni separate della stessa specie su traiettorie diverse e consentire l'accumulo di differenze che alla fine portano alla formazione di nuove specie.


La bellezza nella diversità

Rick Guidotti ha costruito la sua carriera come fotografo di moda fino a quando ha deciso di voler mostrare la bellezza in un modo diverso. Attraverso la sua organizzazione no-profit chiamata Positive Exposure, ha iniziato a scattare bellissime fotografie di bambini e adulti con malattie genetiche che non sempre vediamo in mostra su riviste o cartelloni pubblicitari. Il lavoro di Rick ha evidenziato la bellezza nella diversità umana (in gran parte causata dalla variazione genomica) che puoi vedere la vera gioia nella loro galleria online, "The New Faces of Genetics And Beyond". Rick ha continuato a creare progetti come FRAME (Faces Ridefining the Art of Medical Education), progettato per sostituire le immagini di bambini senza sorriso spesso utilizzate nella letteratura medica e nei libri di testo con fotografie gioiose e divertenti cortometraggi. Come dice Rick, gli studenti di medicina "diventeranno medici migliori, perché hanno visto questi bambini non in crisi. Hanno incontrato questi bambini non in un ambiente clinico, ma hanno visto questi bambini come persone".

Il Progetto Genoma Umano ha anche portato a un cambiamento nella nostra comprensione dei tratti umani e nel modo in cui li insegniamo - un esempio è il colore degli occhi. Per molti anni, agli studenti è stato insegnato che un gene dominante controllava gli occhi marroni o azzurri e che i genitori con gli occhi azzurri non potevano avere figli con gli occhi marroni. Gli scienziati sapevano che il tratto degli occhi blu era in realtà più complicato nonostante ciò che veniva insegnato nelle scuole, ma la tecnologia sviluppata durante e dopo il Progetto Genoma Umano ha aiutato a individuare la reale combinazione di varianti genomiche che determinano il colore degli occhi. In effetti, almeno dieci geni, ciascuno dei quali ha diversi "sapori", contribuiscono al colore degli occhi. È la combinazione di queste varianti genetiche nel genoma di una persona che produce la meravigliosa gamma di colori degli occhi umani. Altri tratti sono ancora più complicati, ad esempio circa l'80% dell'altezza di una persona è controllato da più di 700 varianti genomiche, ognuna con un'influenza molto piccola.

Rick Guidotti ha costruito la sua carriera come fotografo di moda fino a quando ha deciso di voler mostrare la bellezza in un modo diverso. Attraverso la sua organizzazione no-profit chiamata Positive Exposure, ha iniziato a scattare bellissime fotografie di bambini e adulti con malattie genetiche che non sempre vediamo in mostra su riviste o cartelloni pubblicitari. Il lavoro di Rick ha evidenziato la bellezza nella diversità umana (in gran parte causata dalla variazione genomica) che puoi vedere la vera gioia nella loro galleria online, "The New Faces of Genetics And Beyond". Rick ha continuato a creare progetti come FRAME (Faces Ridefining the Art of Medical Education), progettato per sostituire le immagini di bambini senza sorriso spesso utilizzate nella letteratura medica e nei libri di testo con fotografie gioiose e divertenti cortometraggi. Come dice Rick, gli studenti di medicina "diventeranno medici migliori, perché hanno visto questi bambini non in crisi. Hanno incontrato questi bambini non in un ambiente clinico, ma hanno visto questi bambini come persone".

Il Progetto Genoma Umano ha anche portato a un cambiamento nella nostra comprensione dei tratti umani e nel modo in cui li insegniamo - un esempio è il colore degli occhi. Per molti anni, agli studenti è stato insegnato che un gene dominante controllava gli occhi marroni o azzurri e che i genitori con gli occhi azzurri non potevano avere figli con gli occhi marroni. Gli scienziati sapevano che il tratto degli occhi blu era in realtà più complicato nonostante ciò che veniva insegnato nelle scuole, ma la tecnologia sviluppata durante e dopo il Progetto Genoma Umano ha aiutato a individuare la reale combinazione di varianti genomiche che determinano il colore degli occhi. In effetti, almeno dieci geni, ciascuno dei quali ha diversi "sapori", contribuiscono al colore degli occhi. È la combinazione di queste varianti genetiche nel genoma di una persona che produce la meravigliosa gamma di colori degli occhi umani. Altri tratti sono ancora più complicati, ad esempio circa l'80% dell'altezza di una persona è controllato da più di 700 varianti genomiche, ognuna con un'influenza molto piccola.


Creazione: fatti della vita

Il Dr. Parker, uno dei principali scienziati della creazione ed ex relatore di AiG, presenta i classici argomenti per l'evoluzione utilizzati nelle scuole pubbliche, nelle università e nei media e li confuta in uno stile divertente e di facile lettura. Un must per studenti e insegnanti! Questo è un ottimo libro da regalare a un non cristiano come strumento di testimonianza.


Il DNA non è lo stesso in ogni cellula del corpo: rivelate le principali differenze genetiche tra le cellule del sangue e dei tessuti

La ricerca di un gruppo di scienziati di Montreal mette in discussione uno dei presupposti più basilari della genetica umana: che quando si tratta di DNA, ogni cellula del corpo è essenzialmente identica a ogni altra cellula. I loro risultati appaiono nel numero di luglio della rivista Mutazione umana.

Questa scoperta potrebbe minare la logica alla base di numerosi studi genetici su larga scala condotti negli ultimi 15 anni, studi che avrebbero dovuto isolare le cause di decine di malattie umane.

Ad eccezione del cancro, i campioni di tessuto malato sono difficili o addirittura impossibili da prelevare da pazienti vivi. Pertanto, la stragrande maggioranza dei campioni genetici utilizzati negli studi su larga scala si presenta sotto forma di sangue. Tuttavia, se si scopre che le cellule del sangue e dei tessuti non corrispondono geneticamente, questi ambiziosi e costosi studi di associazione sull'intero genoma potrebbero rivelarsi sostanzialmente imperfetti sin dall'inizio.

Questa scoperta è scaturita da un'indagine sulle cause genetiche alla base degli aneurismi dell'aorta addominale (AAA) guidata dal Dr. Morris Schweitzer, dal Dr. Bruce Gottlieb, dalla Dr. Lorraine Chalifour e dai colleghi della McGill University e dell'affiliato Lady Davis Institute for Medical Research presso il Montreal's Ospedale Generale Ebraico. I ricercatori si sono concentrati su BAK, un gene che controlla la morte cellulare.

Quello che hanno trovato li ha sorpresi.

L'AAA è una delle rare malattie vascolari in cui i campioni di tessuto vengono rimossi come parte della terapia del paziente. Quando li hanno confrontati, i ricercatori hanno scoperto importanti differenze tra i geni BAK nelle cellule del sangue e nelle cellule dei tessuti provenienti dagli stessi individui, con il sospetto "innesco" della malattia che risiede solo nel tessuto. Inoltre, le stesse differenze sono state successivamente evidenti in campioni derivati ​​da individui sani.

"Nelle malattie multifattoriali diverse dal cancro, di solito possiamo solo guardare il sangue", ha spiegato Gottlieb, un genetista del McGill's Center for Translational Research in Cancer. "Tradizionalmente, quando abbiamo cercato fattori di rischio genetici per, ad esempio, malattie cardiache, abbiamo pensato che il sangue ci dicesse cosa sta succedendo nel tessuto. Ora sembra che semplicemente non sia così".

"Dal punto di vista genetico, a parte le implicazioni terapeutiche, l'osservazione che non tutte le cellule sono uguali è estremamente importante. Questa è la linea di fondo", ha aggiunto. "Gli studi di associazione a livello di genoma sono stati introdotti con enorme clamore diversi anni fa e le persone si aspettavano enormi scoperte. Stavano per prelevare campioni di sangue da migliaia o centinaia di migliaia di individui e trovare i geni responsabili della malattia.

"Purtroppo, la realtà di questi studi è stata molto deludente e la nostra scoperta potrebbe certamente spiegare almeno uno dei motivi".

L'AAA è un allargamento e un indebolimento localizzati dell'aorta addominale e colpisce principalmente gli uomini caucasici anziani che fumano, hanno la pressione alta e alti livelli di colesterolo. Spesso non ha sintomi, ma può portare a rotture aortiche che sono fatali nel 90% dei casi.

Se le mutazioni scoperte nelle cellule dei tessuti predispongono effettivamente all'AAA, rappresentano un bersaglio ideale per nuove terapie e potrebbero avere implicazioni terapeutiche ancora più ampie.

"Questo avrà probabilmente ripercussioni per le malattie vascolari in generale", ha detto Schweitzer, del Dipartimento di Medicina della McGill. "Non abbiamo ancora esaminato le arterie coronarie o cerebrali, ma sospetto che questa mutazione possa essere presente su tutta la linea".

Schweitzer è ottimista sul fatto che questa scoperta possa portare a nuovi trattamenti per le malattie vascolari nel breve e medio termine.

"La tempistica potrebbe essere da cinque a 10 anni", ha detto. "Dobbiamo prima fare esperimenti di coltura cellulare in vitro, dimostrarlo in un modello animale e quindi sviluppare una molecola o una proteina che influenzerà il prodotto del gene mutato. Questo è il primo passo, ma è un passo importante".

Fonte della storia:

Materiali forniti da Università McGill. Nota: il contenuto può essere modificato per stile e lunghezza.


Come il modello del programma per computer spiega la genetica

Ora che abbiamo definito brevemente il modello del programma per computer, diamo un'occhiata alle strutture e ai modelli in biologia e vediamo come il modello del programma per computer può spiegare queste strutture e modelli. Si prega di notare che l'obiettivo di questo articolo è solo quello di introdurre i programmi per computer e il concetto di variabile nella discussione sul DNA. A causa della natura introduttiva e dello spazio limitato dell'articolo, gli esempi sono notevolmente semplificati. Il lettore sarà aiutato meglio se non deduce dettagli non dichiarati, ma ricorda invece che le macchine utilizzano programmi per computer con variabili per eseguire operazioni estremamente complesse ogni secondo di ogni giorno. Non usano sequenze o frasi casuali. Può anche aiutare i lettori a riconoscere che l'informatica ha interi corsi dedicati alle strutture di dati, quindi il lettore non dovrebbe presumere che la potenza operativa dei programmi per computer sia limitata alle illustrazioni di base in questo articolo.

Tabella 1. Molteplici varianti di un cromosoma semplificato.

Sequenza 1TTGCACCTGCCTAACAACGAAGAAGACAA
Sequenza 2TTGCACCTGCCTAAAATCGAGGAAGACAA
Sequenza 3TTGCACCTGCCTAACAAACTAGATTTACT
Sequenza 4TTGCACCTGCCTAACAACGAAGAAGAACT
Sequenza 5TTGCACCTGCCTAAAATACTAGATTTCAA

Modelli matematici di ereditarietà

Nel discutere il lavoro di Gregor Mendel, Edward Willett descrive le relazioni matematiche trovate negli ormai famosi esperimenti sulle piante di pisello,

Mentre Mendel analizzava i suoi dati, emersero dei modelli. Incrociare piante alte con piante corte, ad esempio, produceva sempre piante alte. Se alle piante alte ibride fosse permesso di autofecondarsi, tuttavia, la generazione successiva avrebbe avuto circa una pianta bassa su quattro. Nella generazione successiva - e in più generazioni dopo quella - le piante basse produssero sempre più piante corte, un terzo delle piante alte produsse solo piante alte, e i restanti due terzi delle piante produssero piante sia alte che basse , nello stesso rapporto di tre a uno . . . Mendel ha ottenuto questi risultati con ognuno dei sette tratti che ha scelto di studiare (Willett 2005, p. 5).

Sebbene l'esempio descritto sia solo uno dei numerosi modelli matematici di ereditarietà osservati in natura, illustra il punto che la variazione non è semplicemente un continuum di modifiche a una sequenza. Ci sono invece quanti discreti che governano l'ereditarietà. Ciò dimostra con forza che le variabili che usiamo per descrivere i tratti ereditari hanno un analogo del mondo reale nel DNA e che un modello di informazione appropriato per il DNA deve contenere variabili. Poiché il modello del programma per computer utilizza le variabili, è eccellente nel rappresentare i modelli matematici dell'ereditarietà.


Quanta variazione c'è tra le molecole di DNA dello stesso organismo - Biologia

Il tuo browser non supporta i frame in linea o è attualmente configurato per non visualizzare i frame in linea.

Storicamente, la chimica e la biologia si sono sviluppate come scienze diverse. Ma man mano che la biologia e la genetica approfondiscono sempre di più lo studio delle molecole, le linee di confine iniziano a confondersi.

Al giorno d'oggi, è comune sentire un termine come "biologia molecolare" o "genetica molecolare" - ma quei termini sarebbero stati incomprensibili per gli scienziati 50 anni fa.

Secondo Erwin Chargaff, il "padre" delle regole dell'appaiamento delle basi, il ponte tra biologia e chimica iniziò a essere compreso solo negli anni '40 con la scoperta da parte di Osward T. Avery che le unità dell'ereditarietà - i geni - erano composte da DNA (che naturalmente è composto da sostanze chimiche: purine e pirimidine).

Le purine sono molecole a doppio anello (basi), mentre le pirimidine sono molecole a singolo anello (basi) e tutto il DNA è costituito da sole quattro sostanze chimiche:

  • (UN) UNdenina (purina)
  • (T) Timina (pirimidina)
  • (C) Cytosina (pirimidina)
  • (G) Guanina (purina)

Ecco le regole di abbinamento di base di Chargaff:

UN si abbina sempre con T

C si abbina sempre con G

Sai già che le purine si legano alle pirimidine, ma perché le purine non possono legarsi alle purine o le pirimidine si legano alle pirimidine?

È perché non c'è abbastanza spazio per due purine per adattarsi all'interno dell'elica e troppo spazio per due pirimidine per avvicinarsi abbastanza da formare legami idrogeno tra di loro. (Come ricorderete, le molecole del DNA sono tenute insieme da legami a idrogeno.)

Per comprendere il legame chimico, devi ricordare che gli atomi hanno un nucleo di protoni con carica positiva e neutroni con carica neutra. Elettroni con carica negativa disposti all'esterno del nucleo.

È come sono disposti questi elettroni e come reagiscono con altri atomi che determina la natura dei legami chimici che si formano tra di loro.

Esistono tre diversi tipi di legami chimici.

  1. Legami ionici (detti anche legami elettrovalenti) si formano tra gli atomi quando uno o più elettroni vengono completamente trasferiti da un atomo all'altro.
  2. Legami covalenti si formano tra gli atomi quando due atomi condividono una o più coppie di elettroni.
  3. Legami di idrogeno si formano tra l'atomo di idrogeno caricato positivamente in una molecola legata in modo covalente e l'area caricata negativamente di un'altra molecola legata in modo covalente.

Come abbiamo detto, le basi del DNA sono tenute insieme da legami idrogeno. Esistono due legami idrogeno tra A e T e tre legami idrogeno tra C e G.

I legami tra l'anticodone di una molecola di tRNA e il codone complementare dell'mRNA sono catalizzati dall'aminoacil-tRNA sintetasi.

Le regole dell'appaiamento di basi ci dicono che se possiamo "leggere" la sequenza dei nucleotidi su un filamento di DNA, possiamo immediatamente dedurre la sequenza complementare sull'altro filamento.

Queste regole spiegano anche il fenomeno che qualunque sia la quantità di Adenina (A) nel DNA di un organismo, la quantità di Timina (T) è la stessa.

Allo stesso modo, qualunque sia la quantità di Guanina (G) nel DNA di un organismo, la quantità di Citosina (C) è la stessa.

Queste relazioni di coppie di basi sono chiamate Regole di Chargaff dal professore della Columbia University il cui team ha osservato per la prima volta le uguali concentrazioni di A e T - e C e G - nella maggior parte delle molecole di DNA.

Ecco le proporzioni relative delle basi nel DNA di alcuni organismi.

Proporzioni relative (%) delle basi nel DNA
Organismo UN T G C
Umano 30.9 29.4 19.9 19.8
Pollo 28.8 29.2 20.5 21.5
Cavalletta 29.3 29.3 20.5 20.7
Riccio di mare 32.8 32.1 17.7 17.3
Grano 27.3 27.1 22.7 22.8
Lievito 31.3 32.9 18.7 17.1


Ecco alcune altre cose da ricordare sull'abbinamento e la codifica di base.

A base deletion early in the coding sequence of a gene may result in a nonsense mutation, a frameshift mutation, multiply missense mutations and a nonfuctional protein.

Base pair substitutions may have little effect on the resulting protein. That's because the redundancy of the code my result in a silent mutation, the missense mutation may not occur in a critical part of the protein, the new amino acid may have similar ties to the replaced amino acid and the wobble phenomenon would result in no change in translation.

Video Instruction
*Availability of You Tube video links may vary. eTAP has no control of these materials.


How much variation is there between DNA molecules from the same organism - Biology

School B iology Notes: The HUMAN GENOME - what is it? what is its importance?

Introduction to the GENOME of an organism & gene expression

The importance of knowing the human genome - the 'project'

Considering chromosomes, alleles, genotypes, phenotypes, variations

Note di revisione della biologia scolastica di Doc Brown: biologia GCSE, biologia IGCSE, biologia livello O,

Gradi USA 8, 9 e 10 corsi di scienze della scuola o equivalente per

14-16 anni studenti di biologia

Questa pagina ti aiuterà a rispondere a domande come . Che cos'è un gene? Cos'è un cromosoma? What is the human genome? What are alleles? What is the difference between genotype and phenotype? Give examples of medical applications of data from the human genome project. Why is genetic testing controversial?

(a) The connection between DNA, genes, alleles, chromosomes and the genome

Il genoma is the whole of the genetic material of an organism - all of the DNA - coding and non-coding!

In animal and plant cells the genetic material (DNA) is contained in the cell nucleus and arranged in 'packages' called cromosomi.

Chromosomes often occur in coppie e.g. human cells have 23 pairs of chromosomes, 46 chromosomes in all.

Every chromosome is a very long strand of DNA that is coiled up to give it a characteristic shape.

Reminders: DNA is a very long natural polimero in which the monomer is a nucleotide that makes up the repeating unit in the molecular chain. The DNA molecule consists of two strands wound and bound together to form the double helix molecule.

For more on structure of DNA see DNA and Protein Synthesis gcse biology revision notes

UN gene is a relatively short strand of DNA that forms a section of a chromosome that codes for a specific protein.

Each gene has the coded instructions to tell a cell to combine a particular sequence of amino acids to form a specific protein. In this case the monomer unit is an amino acid and the resulting polymer is called a protein.

Proteins control the development of an organism's characteristics and all its functions.

As if this wasn't complicated enough, there is an extra layer of complexity due to the existence of alleles!

Genes can exist in different versions called alleli - subtle differences in the genetic DNA code.

Each allele produces a different form of the same characteristic of an organism.

e.g. brown or blue eyes is a good example.

Each chromosome in a pair carries the same genes, BUT, they may carry different alleli.

The diagram below sums up the relationship between all the terms described and explained above.

Nota: Genetic variants

Genetic variants (mutations) are caused by alterations in the common nucleotide sequences in the DNA of genes.

The term variant can be used to describe an alteration that may be benign (harmless), pathogenic (harmful), or of unknown significance.

The term variant is increasingly being used in place of the term mutation.

Variants are key to successful evolution because genotype changes (usually of the smaller type) can lead to changes in phenotype.

Umano variazione genetica è il genetico differences both within and among populations. There may be multiple variants of any given gene in the human population.

A mutation may defined as any change in a DNA compared to normal that results in a rare and abnormal variant .

For more on structure of DNA see DNA and Protein Synthesis gcse biology revision notes

For much more on mutations and variants see Genetic variation and mutations

(b) Genetic instructions and the characteristics of an organism

The combination of all alleles for each gene of an organism are called genotypes.

It is the genotypes of each organism that makes it unico.

However, the characteristics shown by an organism are called their phenotypes.

The phenotype of an organism is primarily determined by the genotype, but the phenotype can be influenced by the environment the organism is interacting with.

e.g. under what conditions does an organism grow and develop?

The diet of an animal can affect how well it grows and how healthy it is. A well nourished child grows strong and healthy. A malnourished child short of protein, vitamins etc. may have stunted growth, be too thin, physically weak and the immune system weakened so the individual is more susceptible to infectious diseases.

A flower exposed to lots of sunlight, rich soil and adequate water may grow a healthily rich green and have attractively coloured flowers. If a plant is deprived of enough sunlight, nutrients or water, it grows somewhat thinly and becomes limp, it tends to be yellowish rather than green and petal colours may fade.

In both of the above cases, the genotype determines the maximum healthy growth of organism, but this may be reduced by environmental factors.

Therefore the variation of the phenotype is determined by a combination of the genotype (genetic factors) and the conditions of growth and development (environmental factors).

(c) The importance of genome knowledge - the human genome project

The genome is the term that describes the total genetic material of an organism - all the DNA.

The human genome projects has mapped and identified all the genes found in human DNA.

Every organism has its own unique genome and scientists can now completely work it out - clever stuff!

Genome data is used to characterise species and help research plant and animal evolution patterns.

See note 3. below on the human genome.

Il human genome has around 3 billion base pairs in the DNA sequences of the genes-chromosomes!

Apparently quite a lot of your DNA is 'Rifiuto', but don't worry, and we won't go into that, just study hard, play hard and enjoy life!

Thousands of scientists around the world have collaborated on the human genome project.

We now know the complete human genome and over 20,000 to 25,000 genes have been located on it, but although we know what many do (code for), there is much more to find out.

Around 1800 genes have been identified that relate to human diseases - and this data is the target of medical research to benefit medicine.

PLEASE NOTE that all humans share 99.9% of their genomes, which makes you think!

How is our understanding of the human genome helping science e.g. evolution theory or medicine?

Any new drug must be targeted at some specific medical condition where there is a need.

The target might be blocking the action of an enzyme or a gene with a chemical agent (drug) you can interfere with the development of a disease e.g. the anti-cancer drugs used in chemotherapy treatments to reduce the growth of tumour cells or kill them.

Studies of the genomes and resulting proteins in both plants and animals are proving useful to identify 'targets'.

You then have to find a chemical that will have an effect on the target, fortunately there are databases of chemicals that have been previously screened for likely effectiveness.

The screening might not initially indicate the best molecule to 'hit the target' in a biochemical sense, but, it may provide a starter molecule - which you can then modify to make different derivative molecules, one of which might provide a more effective treatment.

e.g. prediction and prevention of disease, testing for and treating inherited diseases, more effective medicines, BUT, there are ethical issues to deal with too.

1. It has been possible for genetic scientists to identify particular genes (genetic variants) in the genome that are linked to certain types of non-inherited diseases .

Hopefully it will lead to predicting predisposition to certain diseases, leading to early intervention with medical treatment and perhaps a preventing disease actually developing.

If you know what genes predispose people to certain diseases, medical advice can be more accurately given e.g. choice of diet and other lifestyle factors based on the results of genetic screening tests.

Many common diseases like cancer and heart conditions are caused by the interaction of different genes, as well as lifestyle factors.

Guarda anche I ntroduction to genetic variation - formation and consequence of mutations

and Stem cells and uses - leukaemia treatment

2. From the human genome project, by knowing the genes associated with an inherited disease ( genetic disorder ), we can understand it more clearly and then develop more effective treatments - which may involve genetic engineering si.

We know inheriting certain genes greatly increase your risk of developing certain cancers, this can help with making lifestyle choices to minimise the risk of suffering from the disease - as with 1. above, its a sort of risk management situation.

In the UK newborn babies are routinely tested for particular genetic variants known to cause genetic disorders e.g. the double recessive allele that causes cystic fibrosis.

The results from genetic screening enables the medical treatment-management to begin promptly while the baby is still very young.

Children with leukaemia can have a genetic test to help decide which is the most effective treatment in terms of medication and its dose.

See further notes on genetic screening of an embryos or fetus (much more controversial)

e Introduction to the inheritance of characteristics and inherited disorders

It is hoped that all this new genetic science will lead to the development of better, and more personal, treatments for a wide range of medical conditions.

We are now developing drugs and other techniques that work at the molecular level in combating disease and tailored to suit the individual's body chemistry.

The variations in patients genetic variants (alleles) mean that one drug isn't necessarily as effective with all patients suffering from the same condition - so new drugs can be designed to suit these 'varying' patient situations.

3. We know certain alleles affect how our body responds to certain diseases and their treatment.

Scientists hope to use this knowledge to develop more effective drugs that can be specifically suited to patients with certain alleles in their genome.

Different drugs can be tested, and their effectiveness compared with the patient's alleles, and you can compare existing drugs with new ones.

It has been found that some breast cancer drugs are only effective in women if they have certain alleles in their genome.

4. To help in these medical quests, scientists are analysing the genomes of human pathogens to help us understand and control certain infectious diseases.

The complete genome of bacteria such as the deadly MRSA, which is resistant to antibiotics.

It is hoped that pathogen genome knowledge will allow swifter decisions as to the best treatment administered to patients i.e. determined by the genomics of the specific bacterial strain.

The science of human e volution and migration

The human genome project can be tackled by various genetic strategies.

(i) Analysis of data from people's Y chromosome inherited down the male line.

(ii) Analysing mitochondrial DNA inherited through mothers.

Our knowledge of the human genome is being used to trace the migration of certain populations across the continents of the world.

The latest research suggests that all modern humans have descended from a common ancestor who lived in Africa, and their descendents have spread over all over the Earth - moving by both land and sea.

This is known as the 'Fuori dall'Africa' theory and seems to have begun around 60 000 years ago.

Why did this happen?

Maybe change in climate, so seeking more food for hunter-gathering tribes?

It is known the climate in Africa at this time became much dryer - less rain, less plant life, less food for animals, less plants and animals for humans to eat.

All humans have a very similar genome .

In terms of ancestors - genetically, who you were and where you have been is 'hidden' in your genome! until, that is, modern DNA analysis reveals all .

However, as different populations of people migrated to different areas of the planet, small differences in DNA 'evolved' (incorporated) into their genome e.g. producing different skin or hair colour or facial features.

The genetic variation is as little as 0.001%, but even so, genetic scientists can work out when these new populations split off in a different 'genetic' and geographical direction.

People who are related will have an even more similar genome.

The human genome is being compared to some of closest relative in the world e.g. primates.

Ever since researchers sequenced the chimp genome in 2005, they have known that humans share about 99% of our DNA with chimpanzees, making them our closest living relatives - that should make you think!

(d) Genetic screening - using data from the human genome project - potential medical treatments - issues

introduzione

When you know that a particular allele causes an inherited genetic disorder you can take action e.g.

if an allele that causes an inherited disorder is identified, we could have regular medical checks for these specific diseases and get early diagnosis and subsequent treatment.

Genetic treatment might be able to cure the disease.

From the human genome project scientists can identify the genes and alleles that may be responsible for causing inherited disorders, and much faster prior to the mapping of the complete human genome.

Common diseases like cancer and heart conditions are caused by the interaction of our genes and our lifestyle factors.

If we know which genes predispose an individual to certain types of disease we could be given personal advice on diet and lifestyle (in general) to minimise the risk of suffering from particular diseases.

However, there are many issues to with genetic testing results e.g.

(i) From the point of view of potential parents, there maybe crucial choices regarding whether children may be born with a genetically inherited disorder - especially if both parents carried the same faulty allele.

(ii) Would compagnie di assicurazione be allowed to see your 'genetic profile', are they entitled to know it e.g. as regards health or life insurance?

More on these points below in section (d)

Examples of using genetic testing

Example 1. A couple wishing to start a family might wish to know whether there is a rischio of the baby developing a genetic disorder. This another aspect of family planning at the discretion of parents.

This can involve genetic testing at various point e.g.

1. Prior to conception, parents can be tested to see if they are carriers of a defective gene known to cause a genetic disorder.

It may be known that one of the parents comes from a family line where a genetic disorder has occurred.

The parents may not suffer from the genetic disorder, but they may be a carrier of the defective gene.

The genetic tests would show if any parent was a carrier and the probability of the baby inheriting the disorder - the parents can then make an 'informed decision' as to whether to have a child.

vedere Introduction to the inheritance of characteristics and inherited disorders

2. After conception or laboratory fertilisation, the embryo or feto (embryo >8 weeks old) can be tested - see section (ii) below on embryonic genetic testing.

A pregnant woman can be tested by extracting a sample of DNA from the amniotic fluid which surrounds the fetus in the womb - there is a very small risk of causing a miscarriage.

The tests will show whether the foetus's DNA is carrying any of the genetic variants linked with a disorder.

If a positive test for such a variant is found, the couple can then make an 'informed decision' as to whether to terminate or continue with the pregnancy - a very personal and agonising family planning decision.

3. The newborn baby can be genetically tested to show whether a genetic disorder has been inherited allowing early intervention of medical treatment and subsequent long-term management of the disorder.

Example 2. Using in vitro fertilisation (IVF) embryos are fertilised in a laboratory and then implanted into the mother's womb.

Prior to implantation it is possible to remove a cell from an embryo and analyse the DNA i.e, the genes and likely genotypes/phenotypes.

This allows the detection of genetic disorders e.g. cystic fibrosis (described above) which is caused by the presence of one or more faulty genes.

You can choose to allow a genetic disorder free embryo to fully develop into a baby in the mother's womb - this minimises the baby inheriting the genetic variants linked with the disorder.

However, this ability to analyse genes in this way leads to ethical, social and economic concerns and questions about embryonic testing i.e. embryo screening for abnormal-undesired genetic traits, on which crucial decisions can be made e.g. termination of pregnancy.

e.g. after screening, embryos produced by IVF, containing abnormal alleles can be destroyed.

Example 3. Other points on genetic testing

Genome research data shows scientists the common genetic variations between people, most of which are benign and no danger to our health.

However, as I've already pointed out:

Some genetic variations are linked to our predisposition to certain disease - so this will help to design new drugs specifically tailored to suit people of a particular genetic trait.

In the UK newborn babies are routinely tested for particular genetic variants known to cause genetic disorders e.g. the double recessive allele that causes cystic fibrosis.

The results from genetic screening enables the medical treatment-management to begin promptly while the baby is still very young.

Arguments for embryonic/fetal screening and other genetic testing

(i) It stops newborn babies suffering as they grow up into adults.

(ii) Reducing the number of people suffering with a genetic disorder that is costly for healthcare systems to deal with.

(iii) Procedures like IVF, accompanied by genetic testing, are strictly regulated and parents are not allowed to choose desirable traits.

Parents are not allowed to choose the sex of their child, unless it is for good medical health reasons.

(IV) Other 'positive' points on genetic testing:

Early intervention for potentially serious diseases has already been mentioned.

Drugs for chemotherapy in cancer treatment are continually being developed and tested - you match a drugs performance against a person's specific genetic profile - this increases a 'working' database of treatment for future patients - another positive outcome from such treatment research is the minimising of side-effects which can quite drastic from ant-cancer drugs.

Arguments against embryonic/fetal screening and other genetic testing

Many objections centre around the ethical issues of IVF .

(i) IVF procedures often result in unused embryos being destroyed and some people consider this unethical - immoral, because you have destroyed a potential human life.

Even using embryos in research projects is considered to be unethical.

(ii) Terminations of IVF pregnancies on the grounds the baby may be born with a genetic disorder implies that the resulting children are undesirable and prejudice increased towards them.

Would potential parents feel under pressure NOT to have children with a potentially inherited genetic disorder.

(iii) The genetics and genetic testing of embryos before implantation in the mother's womb raises the ethical issue of preferential choice of characteristics of the baby e.g. choice of gender, eye colour irrespective of whether you allow a child to be born with disabilities.

(iv) Genetic screening is caro e il costs of gene technology treatments are high.

The cost increases, the more personal the treatment, because the more specialised the drugs must be.

Surely this risks unfair access to these expensive treatments?

In the UK NHS treatment is free - BUT, is it locally available? Can you jump the queue by using private medicine?

In other countries, or UK private medicine - what does your insurance premium cover?

(v) The accuracy of genetic testing

Unfortunately, due to the complexity of DNA structure, genetic testing is not 100% accurate.

UN positive test for a faulty gene, that is incorrect, will causing stress to the couple, and possibly the wrong decision to terminate a pregnancy because of paura of the baby inheriting a genetic disorder when there is actually no need to be concerned.

UN negative test for a faulty gene, that is incorrect, means the couple are completely unprepared for the birth of a child with a genetically inherited disorder, causing considerable stress in their lives when the baby is born.

(vi) Other 'negative' points on genetic testing:

Is the use of gene technology good in the long term, since we don't actually know what the effects will be on future generations?

What might you think if you know from an early age you are more susceptible (more predisposed) to a particular disease? Won't this lead to fatica thinking about it, especially if there isn't cure for it? Might you feel uneasy and worried if you 'sembrare' to exhibit symptoms?

Would you be discriminated against by compagnie di assicurazione (e.g. insurance refusal or increased premiums) or employers (e.g. refused long-term job contract) if they knew you were likely to suffer from a genetically inherited disorder.

Society must decide on a code of conduct relating to potential discrimination AND privacy of your medical details.

Just imagine the problems caused if you genetic profile had to be submitted with a job application!

IGCSE revision notes genomes organism's characteristics genotype phenotype KS4 biology Science notes on genomes organism's characteristics genotype phenotype GCSE biology guide notes on genomes organism's characteristics genotype phenotype for schools colleges academies science course tutors images pictures diagrams for genomes organism's characteristics genotype phenotype science revision notes on genomes organism's characteristics genotype phenotype for revising biology modules biology topics notes to help on understanding of genomes organism's characteristics genotype phenotype university courses in biological science careers in science biology jobs in the pharmaceutical industry biological laboratory assistant apprenticeships technical internships in biology USA US grade 8 grade 9 grade10 AQA GCSE 9-1 biology science notes on genomes organism's characteristics genotype phenotype GCSE notes on genomes organism's characteristics genotype phenotype Edexcel GCSE 9-1 biology science notes on genomes organism's characteristics genotype phenotype for OCR GCSE 9-1 21st century biology science notes on genomes organism's characteristics genotype phenotype OCR GCSE 9-1 Gateway biology science notes on genomes organism's characteristics genotype phenotype WJEC gcse science CCEA/CEA gcse science


Virus a DNA vs virus a RNA

Qual è la differenza tra virus a DNA e virus a RNA?

I virus a DNA a singolo filamento sono molto meno comuni dei virus a DNA a doppio filamento. Con i virus a RNA, è l'opposto: ci sono alcuni esempi di virus a RNA a doppio filamento, ma prevalentemente sono a filamento singolo.

La struttura del virus HIV (immunodeficienza umana)

La differenza cruciale tra i due tipi di virus è nella loro capacità di sintetizzare le proteine. Mentre i virus a DNA devono trascrivere il DNA in RNA per poter sintetizzare le proteine, i virus a RNA possono usare il proprio RNA virale per farlo.


Replication - DNA Synthesis [back to top]

DNA is copied, or replicated, before every cell division, so that one identical copy can go to each daughter cell. The method of DNA replication is obvious from its structure: the double helix unzips and two new strands are built up by complementary base-pairing onto the two old strands.

DNA replication can take a few hours, and in fact this limits the speed of cell division. One reason bacteria can reproduce so fast is that they have a relatively small amount of DNA.

This replication mechanism is sometimes called semi-conservative replication, because each new DNA molecule contains one new strand and one old strand. This need not be the case, and alternative theories suggested that a "photocopy" of the original DNA could be made, leaving the original DNA conserved (conservative replication). The evidence for the semi-conservative method came from an elegant experiment performed in 1958 by Meselson and Stahl. They used the bacterium E. coli together with the technique of centrifugazione in gradiente di densità, which separates molecules on the basis of their density.

1. Grow bacteria on medium with normal 14 NH4

2. Grow bacteria for many generations on medium with 15 NH4