Informazione

Stessi primer e diversi picchi di fusione per due campioni (~1°C a parte)

Stessi primer e diversi picchi di fusione per due campioni (~1°C a parte)



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Nella figura si può vedere che i picchi di fusione differiscono di ~1°C ad ogni campione.

Dovrei essere preoccupato?


Frontiere in microbiologia

Le affiliazioni dell'editore e dei revisori sono le ultime fornite nei loro profili di ricerca Loop e potrebbero non riflettere la loro situazione al momento della revisione.



CONDIVIDERE SU

MATERIALI E METODI

Ceppi batterici e campioni fecali clinici.

I ceppi di riferimento utilizzati per lo sviluppo del dosaggio e la valutazione delle specificità biprobe sono elencati nella tabella ​ Table1. 1 . Per valutare il saggio, 46 C. jejuni e 13 C. coli Sono stati testati i ceppi di riferimento del sierotipo Penner. Inoltre, sono stati testati 110 isolati di campo già identificati a livello di specie per fenotipo, questi sono stati codificati in cieco e comprendevano 26 C. jejuni, 12 C. coli, 13 C. lari, 24 C. upsaliensis, 13 C. feto, 11 C. helveticus, 10 C. hyointestinalise 1 C. lanienae isolato.

TABELLA 1

Ceppi di riferimento di Campylobacter, Arcobacter, e Helicobacter specie

SpecieFonte a
Campylobacter sp.
𠀼. digiuno subsp. digiunoNCTC 11351 T
𠀼. digiuno subsp. doyleiNCTC 11951 T
𠀼. coliNCTC 11350
𠀼. lariNCTC 11352 T
𠀼. upsaliensisNCTC 11541 T
𠀼. elveticoNCTC 12470 T
𠀼. feto subsp. fetoNCTC 10842 T
𠀼. feto subsp. venerealeNCTC 10354 T
𠀼. hyointestinalis subsp. hyointestinalisNCTC 11608 T
𠀼. sputorum subsp. sputorumNCTC 11528 T
𠀼. sputorum subsp. faecalisNCTC 11415 T
𠀼. sputorum subsp. bubuloNCTC 11367 T
𠀼. gracileNCTC 12738 T
𠀼. concisoNCTC 11485 T
𠀼. rettoNCTC 11489 T
𠀼. curvoNCTC 11649 T
𠀼. spettacoloNCTC 12843 T
𠀼. mucosalisNCTC 11001
𠀼. lanienaeNCTC 13004 T
 [batterioidi] ureolitico B NCTC 10941 T
Helicobacter sp.
 H. canisNCTC 12739 T
 H. pullorumNCTC 12824 T
 H. rappiniNCTC 12461 T
 H. acinonyxNCTC 12686 T
 H. cinaediNCTC 12423 T
 H. fennelliaeNCTC 11612 T
 H. mustelaeNCTC 12198 T
 H. piloriNCTC 11637 T
 H. hepaticusATCC 51448 T
 H. muridarumNCTC 12714 T
 H. pamatensisATCC 51478 T
 H. nemestriaeNCTC 12491 T
Arcobacter sp.
𠀺. criaerofiloNCTC 11885 T
𠀺. skirrowiiNCTC 12713 T
𠀺. butzleriNCTC 12481 T
𠀺. nitrofigileNCTC 12551 T
Wollinella succinogenesNCTC 11488 T

Sono stati testati trentotto campioni fecali di pazienti con gastroenterite provenienti da uno studio su larga scala (13). Da 24 di questi campioni, i campilobatteri sono stati identificati a livello di specie mediante PCR-ELISA (15 C. jejuni, 2 C. coli, 2 C. hyointestinalise 5 C. upsaliensis isolati). Da 19 di questi 24, Campylobacter era stato identificato a livello di genere mediante coltura selettiva. I restanti 14 campioni clinici sono risultati negativi sia per Campylobacter PCR-ELISA e coltura: in 9 campioni non sono stati rilevati organismi patogeni, mentre 1 campione è risultato positivo per Salmonella, 1 per Shigella, 1 per Escherichia coli, 1 per Criptosporidioe 1 per Giardia.

Preparazione del campione.

Una sospensione di colonia bollita in acqua sterile è stata preparata da colture su piastra di agar sangue di 24-48 ore. Gli estratti di DNA archiviati conservati a �ଌ sono stati testati retrospettivamente Il DNA è stato estratto da questi campioni fecali come descritto in precedenza (4, 12).

PCR e analisi del picco di fusione biprobe.

La PCR simmetrica è stata eseguita su un RoboCycler (Stratagene, La Jolla, California) utilizzando precedentemente descritto Campylobacter primer specifici del genere (16) C412F (GGA TGA CAC TTT TCG GAG C) e C1228R (CAT TGT AGC ACG TGT GTC).

La PCR asimmetrica eminestata e l'analisi del picco di fusione sono state eseguite in capillari di vetro in un apparato LightCycler (Bio/Gene Ltd., Kimbolton, Regno Unito) (34, 35) utilizzando 1 μl di prodotto PCR di primo ciclo in un volume totale di 10 μl. La PCR asimmetrica viene utilizzata per produrre copie in eccesso del filamento complementari alle bisonde. La miscela di reazione conteneva 2,5 pmol del primer singolo C690F (AGATACCCTGGTAGTCCACG), 50 mM Tris-HCl (pH 8,3), 5 mM MgCl2, 0,5 mg di albumina sierica bovina/ml, 200 μM ciascuno deossinucleosidi trifosfato, 0,4 U di platino Taq DNA polimerasi (Life Technologies Ltd., Paisley, Regno Unito), SYBR Green 1 (Bio/Gene Ltd.) a 0,01% e 5 pmol di biprobe marcato all'estremità 5′ con Cy5 e al 3′ finire con la biotina. Questo tipo di sistema di rilevamento dell'acido nucleico è soggetto a un brevetto detenuto dalla Defense Evaluation Research Agency, Farnborough, Regno Unito e da Bio/Gene Ltd. (3). I primer e le sonde erano di qualità HPSF (highly purificated salt free), sintetizzati da MWG-Biotech UK Ltd., Milton Keynes, Inghilterra. Il ciclo termico e le condizioni di acquisizione della fluorescenza comprendevano un ciclo di denaturazione iniziale a 95ଌ per 10 s e 40 cicli di amplificazione (con una velocità di transizione della temperatura di 20ଌ/s) di 95ଌ per 0 s annealing a 60ଌ per 10 s , ed estensione a 74ଌ per 30 s. Le letture di fluorescenza sono state effettuate dopo ogni ciclo successivo alla fase di estensione. Questa è stata seguita dall'analisi della fusione del duplex prodotto sonda-PCR costituito da 95ଌ per 0 s, quindi raffreddamento a 40ଌ prima che la temperatura fosse aumentata a 99ଌ a una velocità di 0,1ଌ/s con fluorescenza continua acquisizione.


Chi è chi? Analisi di fusione ad alta risoluzione per distinguere tra le specie di lepre utilizzando un campionamento non invasivo

L'identificazione della specie è un passaggio cruciale in molti studi ecologici. A volte, questo potrebbe diventare una sfida, a causa del comportamento elusivo degli animali, della popolazione a bassa densità o per specie simpatriche che lasciano segni simili che sono impossibili da discriminare in base solo alla loro morfologia. Qui, abbiamo impostato un metodo molecolare non invasivo per discernere tra la lepre italiana (Lepus corsicanus) e la lepre europea (Lepus europaeus) utilizzando il test di fusione ad alta risoluzione sul DNA fecale, per la prima volta su queste specie. La lepre italiana è endemica dell'Italia centro-meridionale e della Sicilia ed è classificata vulnerabile dall'Unione Internazionale per la Conservazione della Natura. La nostra procedura potrebbe essere uno strumento utile per aiutare le strategie di conservazione e gestione, principalmente nelle aree in cui la lepre italiana e la lepre europea vivono in simpatria. Il 9,5% dell'areale peninsulare della lepre europea è occupato dall'areale della lepre italiana. Il nostro flusso di lavoro consente una sicura discriminazione delle specie, in modo rapido ed economico (in un giorno potrebbero essere elaborati almeno 36 campioni a un costo di circa 259 euro, comprese sia le estrazioni del DNA che la corsa HRM), anche quando è necessario elaborare un numero elevato di campioni. Inoltre, il nostro metodo potrebbe essere ampiamente applicabile ad altri Lepus e/o specie di mammiferi con preoccupazioni simili, con piccoli aggiustamenti al protocollo e alla sua ulteriore convalida, concentrandosi sui primi e sulla corrispondente temperatura di ricottura HRM.

Questa è un'anteprima del contenuto dell'abbonamento, accedi tramite il tuo istituto.


Risultati

Verifica del primer e condizioni di qPCR

È stata eseguita un'amplificazione non specifica per confermare ciascuna coppia di primer utilizzando la Tm mostrata nella Tabella 1 con il modello di cDNA dei geni bersaglio preparati in precedenza. I prodotti di amplificazione sono stati analizzati mediante elettroforesi su gel di agarosio in cui è stata osservata una singola banda luminosa (Fig. 1a-c). Gli ampliconi della PCR sono stati sequenziati per affermare le sequenze degli ampliconi per tutti i geni valutati nel presente studio.

Verifica del primer mediante amplificazione PCR dalla catepsina B (un), catepsina D (B) e fosfatasi acida (C) di H. longicornis

Cambiamenti dinamici della catepsina B durante lo sviluppo embrionale

I livelli di espressione relativa della catepsina B nelle uova di diverse fasi dello sviluppo embrionale sono stati misurati individualmente mediante PCR quantitativa in tempo reale. I risultati hanno mostrato che la catepsina B è stata espressa quasi durante lo sviluppo dell'uovo tranne che per il primo e l'ultimo giorno (Fig. 2a). Un accumulo con significativa sovraregolazione della catepsina B è stato osservato nelle uova durante i primi cinque giorni e ha raggiunto la sua massima espressione il giorno 5 (ANOVA, F(8,45) = 100.02, P < 0,0001). Tuttavia, l'espressione dell'mRNA della catepsina B è diminuita costantemente, insieme al progresso dello sviluppo embrionale (Fig. 2a).

Espressione (un) e attività enzimatica (B) profilazione della catepsina B durante lo sviluppo embrionale in H. longicornis. Ogni punto rappresenta la media ± SEM di tre esperimenti biologici indipendenti e le diverse lettere indicano differenze significative (P < 0,05)

Il profilo dell'attività enzimatica della catepsina B è mostrato in Fig. 2b. Il primo giorno è stato osservato un alto livello di attività della catepsina B rispetto alle fasi successive dello sviluppo. L'attività è diminuita significativamente al terzo e quinto giorno e poi è rimasta relativamente bassa fino alla fine dello sviluppo dell'uovo (ANOVA, F(8,45) = 39.66, P < 0,0001) (Fig. 2b).

Cambiamenti dinamici della catepsina D durante lo sviluppo embrionale

Abbiamo analizzato i profili di espressione della catepsina D in diverse fasi di sviluppo dell'embriogenesi delle zecche. A livello trascrizionale, l'espressione della catepsina D era carente nei primi nove giorni e ovviamente aumentava il giorno 11, ma poi calava rapidamente e drammaticamente (ANOVA, F(8,45) = 269.59, P < 0,0001) (Fig. 3a).

Espressione (un) e attività enzimatica (B) profilazione della catepsina D durante lo sviluppo embrionale in H. longicornis. Ogni punto rappresenta la media ± SEM di tre esperimenti biologici indipendenti e le diverse lettere indicano differenze significative (P < 0,05)

Come mostrato in Fig. 3b, l'attività della catepsina D si è ridotta lentamente nei primi tre giorni ma è aumentata gradualmente durante i sette giorni successivi. La massima attività della catepsina D è stata osservata il giorno 13 per poi tornare allo stesso livello dei primi tre giorni (ANOVA, F(8,45) = 21.08, P < 0.0001) (Fig. 3b).

Cambiamenti dinamici della fosfatasi acida durante lo sviluppo embrionale

Per la fosfatasi acida, l'analisi di espressione relativa ha rivelato che i livelli di mRNA sono stati prima osservati il ​​giorno 5 e poi accumulati con un aumento significativo (ANOVA, F(8,45) = 140.08, P < 0,0001). Raggiunse la massima espressione il giorno 11 e si ridusse rapidamente fino alla fine dello sviluppo (Fig. 4a).

Espressione (un) e attività enzimatica (B) profilazione della fosfatasi acida durante lo sviluppo embrionale in H. longicornis. Ogni punto rappresenta la media ± SEM di tre esperimenti biologici indipendenti e le diverse lettere indicano differenze significative (P < 0,05)

A differenza della catepsina B e D, l'attività della fosfatasi acida è aumentata significativamente nei primi cinque giorni, per poi rimanere stabile ad alti livelli fino alla fine dello sviluppo dell'uovo (ANOVA, F(8,45) = 17.05, P < 0.0001) (Fig. 4b).


Risultati

Genotipizzazione di campioni standard mediante analisi HRM del gene Cyt b

Tutti i campioni analizzati hanno amplificato un prodotto di 383 bp, come precedentemente riportato al gene Cyt b [29] (dati non mostrati) e nessun prodotto è stato ottenuto quando il DNA dell'insetto o T. cruzi è stato utilizzato il DNA. La curva di fusione dell'amplicone e Tm hanno mostrato una bassa variabilità intraspecie (Tabella 2, Figura 1). È stato osservato un profilo specifico per ciascuna specie analizzata ( Figure 2 e S1), con percentuali di confidenza (ɜ) comprese tra 78.81% e 98.69% ( Tabella 2) , indicando che i campioni sono stati correttamente identificati in ciascuno dei esperimenti condotti in triplicato.

Tm: temperatura di fusione, Sp: specie.

Tavolo 2

Analisi TmAnalisi HRM
SpTmSD95% CI di TmVCGenotipo TmGenotipo HRMɜɜ SD
Opossum81.020.0980.97�.060.10OpossumOpossum81.2415.02
Topo81.630.1281.57�.690.14TopoTopo94.194.94
Mucca81.760.4981.51�.000.60MuccaMucca83.0716.63
Capra81.880.0581.86�.910.06CapraCapra88.2413.25
Cane82.290.0882.25�.330.09CaneCane90.9213.86
Pecora82.290.0382.26�.330.04PecoraPecora98.691.50
Cavallo82.560.0882.52�.600.10CavalloCavallo93.469.04
Maiale82.580.0582.55�.600.06MaialeMaiale95.189.50
Coniglio82.690.0582.66�.720.06ConiglioConiglio98.551.33
Gatto83.460.0983.41�.500.11GattoGatto78.8122.40
Ratto83.550.0583.50�.590.05RattoRatto89.906.51
Asino84.390.0484.36�.410.05AsinoAsino87.8522.14
Umano85.790.0585.76�.820.06UmanoUmano96.582.22
Pollo86.270.0586.24�.290.06PolloPollo93.0518.01

Sebbene alcune specie mostrassero lo stesso valore Tm, i profili HRM in queste specie erano chiaramente discriminati e riconosciuti come genotipi differenti, come cane e pecora o maiale e cavallo (Tabella 2, Figura S1). D'altra parte, sebbene la curva di fusione delle vacche abbia mostrato due picchi, il genotipo è stato riconosciuto con un'alta percentuale di confidenza (Tabella 2). Questi due picchi sono stati trovati in diversi tipi di campioni (muscolo e sangue).

Convalida della tecnica HRM per identificare le fonti di farina di sangue nelle triatomine

Analisi del contenuto intestinale e delle feci di diverse specie di insetti

Il profilo HRM del gene Cyt b ottenuto da feci e contenuto intestinale da R. colombiensis, R. prolixus, e T. maculata alimentati con sangue di pollo sono stati analizzati e classificati in base ai genotipi definiti con i campioni standard. Tutti i campioni sono stati correttamente classificati come pollo nutrito con sangue (C) e solo uno dei campioni ottenuti dalle feci (R. prolixus) ha mostrato una bassa percentuale di confidenza. La tabella S2 riassume i risultati delle amplificazioni ottenute per ciascuna di queste specie.

Analisi del contenuto intestinale e delle feci in momenti diversi dopo l'alimentazione e dopo l'alimentazione mista

Tutti i campioni sono stati amplificati con successo mediante qPCR 1, 5, 15 e 30 giorni dopo l'alimentazione (Tabella 3). Il contenuto intestinale e i campioni di feci hanno mostrato un'amplificazione e un rilevamento di successo della fonte di farina di sangue dopo 30 giorni dopo l'alimentazione, indicando l'elevata sensibilità di Cyt b-HRM in questo momento. È interessante notare che i campioni di insetti nutriti con esseri umani hanno mostrato un picco classificato come genotipo di pollo a 1 e 5 giorni dopo l'alimentazione. Questo risultato non è sorprendente considerando che gli insetti sono stati mantenuti in condizioni di laboratorio con farina di sangue di pollo prima di nutrirsi con sangue umano. Tuttavia, dopo 15 giorni dall'alimentazione, è apparso un secondo picco che corrispondeva al genotipo umano (Tabella 3).

Tabella 3

Analisi TmAnalisi HRM
AlimentazioneFonte del campioneCorso di tempo (giorni)Tm1SDGenotipo Tm1Tm2SDGenotipo Tm2Genotipo HRMHRM ɜɜ SD
hCIRCUITO INTEGRATO186.240.02CG---CG55.2310.84
hCIRCUITO INTEGRATO586.280.03CG---CG89.498.73
hCIRCUITO INTEGRATO586.30.03CG---CG82.158.77
hCIRCUITO INTEGRATO1581.170.06m85.890.06hnsnsns
hCIRCUITO INTEGRATO1581.430.04m86.470.02Cnsnsns
hCIRCUITO INTEGRATO3086.260.01CG---CG61.323.10
hCIRCUITO INTEGRATO3085.790.01HG---HG63.655.66
hF3081.540.01m85.970.03hnsnsns
hF3085.90.05HG---HG21.751.93
CCIRCUITO INTEGRATO186.320.03CG---CG94.493.60
CCIRCUITO INTEGRATO186.320.03CG---CG96.831.80
CCIRCUITO INTEGRATO186.280.02CG---CG89.455.88
CCIRCUITO INTEGRATO586.340.01CG---CG93.851.11
CCIRCUITO INTEGRATO586.340.04CG---CG95.564.01
CCIRCUITO INTEGRATO1586.350.00CG---CG97.111.80
CCIRCUITO INTEGRATO1586.310.01CG---CG962.75
CCIRCUITO INTEGRATO3086.340.04CG---CG91.938.59
CCIRCUITO INTEGRATO3086.320.02CG---CG98.370.05
CF3086.410.05CG---CG33.3718.35

Pertanto, abbiamo valutato la possibilità di rilevare almeno due diverse fonti di farina di sangue. In questo caso, la curva di melting mostrava due picchi appartenenti ad ampliconi di topo e di pollo, con le rispettive Tm. Inoltre, la curva di dissociazione aveva una forma con due cadute (Figura S2). Questi tipi di curve sono state analizzate modificando l'area di normalizzazione ad ogni caduta della curva per riconoscere separatamente i genotipi con il rispettivo genotipo standard.

Identificazione delle fonti di sangue nelle triatomine dal campo

L'analisi HRM di Cyt b in R. prolixus raccolti all'interno delle abitazioni hanno indicato che cinque dei sei individui valutati avevano almeno una fonte di farina di sangue umano e il restante una fonte di farina di sangue di cane (Tabella 4). Due peridomiciliari T. dimidiata hanno mostrato fonti miste di farina di sangue (umano e cane umano e una fonte non identificata) (Tabella 4). silvatico T. dimidiata ha mostrato una fonte mista di farina di sangue di opossum, umano e una fonte non identificata. Di due T. maculata catturato in una casa, si è scoperto che uno si era nutrito di una fonte di farina di sangue umano, mentre l'altro aveva una fonte mista umana e non identificata. Infine, il silvatico E. cuspidatus e R. pallescens sono stati identificati come alimentati con sangue da fonti umane, di pollo e non identificate (Tabella 4, Figura 3).

Tabella 4

Analisi del picco di temperatura più bassoAnalisi del picco di temperatura più alta
CampioneTm1SDGenotipo Tm1Genotipo HRMHRM ɜSDTm2SDGenotipo Tm2Genotipo HRMHRM ɜSD
186.070.07UmanoUmano83.2914.60------
285.960.06UmanoUmano90.985.02------
385.960.05UmanoUmano81.846.48------
486.150.06UmanoUmano75.412.02------
586.030.04UmanoUmano90.913.56------
682.040.08CaneCane56.483.30------
782.020.15CaneCane53.6825.8186.140.04UmanoUmano64.5614.75
984.740.02nsnsnsns86.130.03UmanoUmano63.119.50
1084.870.21nsnsnsns86.100.04UmanoUmano78.9015.17
1281.160.01OpossumOpossum86.0211.1986.100.03UmanoUmano82.243.30
1486.150.02UmanoUmano56.356.93------
1584.850.09nsnsnsns86.200.06UmanoUmano40.7611.44
1686.190.06UmanoUmano57.2311.38------
1984.850.08nsnsnsns86.160.01Umanonsnsns
2086.580.02PolloPollo88.717.08------

Come accennato in precedenza, quattro campioni misti, incluso un insetto intradomiciliare, hanno mostrato un picco con un Tm =�.83ଐ.05, che non era coerente con nessuno dei nostri standard (Tabella 4), indicando un altro sangue- fonte di cibo che non è stata considerata in questo studio. Cinque campioni non si sono amplificati.

L'analisi della sequenza delle fonti di sangue nelle triatomine ha confermato il risultato dell'HRM

I risultati di Blastn hanno mostrato valori di identità significativi maggiori di 95% per tutti i campioni ad eccezione del campione numero 20 (Tabella 5). L'allineamento multiplo del campione di prova e degli standard ha mostrato grande somiglianza nucleotidica e coerenza con i risultati HRM precedentemente ottenuti. La percentuale di identità tra i campioni raccolti sul campo e i rispettivi standard variava tra 95% e 99% nei campioni di umani e opossum e 57% nel campione di pollo (Tabella 5). Infine, l'albero delle distanze ha mostrato gruppi ben supportati in base ai risultati dell'HRM (Figura S3). Vale la pena ricordare che i campioni raccolti sul campo e sequenziati includevano un campione (numero 12) che era positivo per l'alimentazione mista per l'analisi HRM. In questo caso, l'analisi della sequenza ha identificato anche le due specie (umana (12_1) e opossum (12_2)) (Tabella 5).

Tabella 5

CampioneDescrizione esplosivae-ValueNumero di accessoIdentità con lo standard utilizzato per l'identificazione delle risorse umane
2 H. sapiens0 <"type":"entrez-nucleotide","attrs":<"text":"AY509658.1","term_id":"45655510","term_text":"AY509658.1">> AY509658.198.30%
3 H. sapiens0 <"type":"entrez-nucleotide","attrs":<"text":"AY509658.1","term_id":"45655510","term_text":"AY509658.1">> AY509658.198.32%
4 H. sapiens0 <"type":"entrez-nucleotide","attrs":<"text":"AY509658.1","term_id":"45655510","term_text":"AY509658.1">> AY509658.198.89%
5 H. sapiens0 <"type":"entrez-nucleotide","attrs":<"text":"AY509658.1","term_id":"45655510","term_text":"AY509658.1">> AY509658.198.32%
10 H. sapiens0 <"type":"entrez-nucleotide","attrs":<"text":"AY509658.1","term_id":"45655510","term_text":"AY509658.1">> AY509658.198.89%
12_1 H. sapiens2.00E-161 <"type":"entrez-nucleotide","attrs":<"text":"AY509658.1","term_id":"45655510","term_text":"AY509658.1">> AY509658.194.69%
12_2 D. marsupialis2.00E-167 <"type":"entrez-nucleotide","attrs":<"text":"DQ236278.1","term_id":"82491921","term_text":"DQ236278.1">> DQ236278.198.60%
15 H. sapiens0 <"type":"entrez-nucleotide","attrs":<"text":"AY509658.1","term_id":"45655510","term_text":"AY509658.1">> AY509658.198.89%
16 H. sapiens9.00E-175 <"type":"entrez-nucleotide","attrs":<"text":"HQ384199.1","term_id":"309752308","term_text":"HQ384199.1">> HQ384199.197.49%
19 H. sapiens9.00E-180 <"type":"entrez-nucleotide","attrs":<"text":"AY509658.1","term_id":"45655510","term_text":"AY509658.1">> AY509658.198.04%
20 G. gallus4.00E-33 <"type":"entrez-nucleotide","attrs":<"text":"FM205717.1","term_id":"219930585","term_text":"FM205717.1">> FM205717.159.78%

Astratto

Premessa dello studio:

Per le specie economicamente importanti Calendula officinalis, è stato progettato un saggio di identificazione rapida basato sull'analisi della curva di fusione ad alta risoluzione. Questo test è stato sviluppato per distinguere C. officinalis da altre specie del genere e da altri generi di Asteraceae, e per rilevare C. officinalis come adulterante di campioni di zafferano.

Metodi e risultati:

Per questo studio, cinque marcatori (ITS, rbcL, 5′ trnK-matK, psbA-trnH, trnL-trnF) di 10 Calendula specie sono state sequenziate e analizzate per mutazioni specie-specifiche. Con l'applicazione di due coppie di primer sviluppate situate nella trnK 5′ introne e trnL-trnF, C. officinalis potrebbe essere distinto da altre specie del genere e da tutti i campioni di outgroup testati. adulterazioni di Calendula Il DNA nello zafferano potrebbe essere rilevato fino allo 0,01%.

Conclusioni:

Con il saggio sviluppato, C. officinalis possono essere identificati in modo affidabile e le miscele di questa specie come adulteranti dello zafferano possono essere rilevate a bassi livelli.

Calendula L. (calendula) è il genere tipo della piccola tribù Calenduleae (Asteraceae). Mentre tutti gli altri generi delle Calenduleae sono originari dell'Africa meridionale, Calendula è distribuito nell'emisfero settentrionale. Calendula specie si trovano principalmente nell'area mediterranea, dal Marocco e dalla Spagna all'Iran, a sud verso i monti Hoggar (Algeria) e Yemen (Norlindh, 1946), ea nord in Germania e Polonia. Il centro di distribuzione è l'Africa nordoccidentale, otto specie sono elencate nella Flora del Marocco settentrionale (Valdés et al., 2002). Il genere Calendula consiste di 12 specie annuali o perenni, considerate tassonomicamente complicate a causa delle ibridazioni (Norlindh, 1977 Heyn e Joel, 1983). All'interno del genere, C. officinalis L. (calendula comune) è di particolare importanza per il suo utilizzo come coltura economica. Calendula officinalis i fiori sono utilizzati per scopi farmaceutici ( EDQM, 2014 ), nei prodotti per la cura della pelle a causa della loro attività antinfiammatoria ( Talhouk et al., 2007 ) e come additivi per mangimi per migliorare il colore degli alimenti a causa del loro colore arancione (carotenoidi) (Mukherjee et al., 2011). I fiori delle cultivar di arancia sono usati anche come adulterante della costosa spezia dello zafferano (Marieschi et al., 2012). I frutti di C. officinalis sono ricchi di olio grasso che ha, per la sua composizione insolita, numerose applicazioni tecniche ( Zanetti et al., 2013 ). La calendula comune è anche un'importante pianta ornamentale con numerose cultivar. I capolini hanno un diametro fino a 5 cm, che è relativamente grande rispetto ad altre specie del genere. I capolini variano dal giallo pastello all'arancio intenso e diverse cultivar sono a fiore doppio.

Allo stato attuale, l'identificazione di C. officinalis viene spesso eseguita mediante cromatografia su strato sottile (TLC) (ad alte prestazioni) o utilizzando caratteri morfologici ( EDQM, 2014 AHPA, 2015 ). Per quanto a nostra conoscenza, non esistono ancora metodi basati sul DNA. Si può presumere che TLC non sia in grado di distinguere tutto Calendula specie e che il materiale vegetale lavorato (ad esempio, fiori recisi o macinati) non può essere identificato a livello di specie dalla morfologia. Pertanto, un metodo basato sul DNA per identificare questa specie ha il potenziale per integrare i metodi esistenti nel controllo della qualità. L'analisi della curva di fusione ad alta risoluzione (HRM) si basa sul comportamento di fusione di frammenti di DNA a doppio filamento relativamente corti ed è un metodo post-PCR rapido e affidabile per rilevare mutazioni come polimorfismi a singolo nucleotide (SNP) o indel. Con un aumento lento e graduale della temperatura, viene rilasciato un colorante fluorescente incorporato tra i due filamenti di DNA a seconda della sequenza, del contenuto di GC e della lunghezza dei prodotti della PCR, determinando una curva di fusione specifica (Ririe et al., 1997 Liew et al. , 2004).

Rispetto al sequenziamento di marcatori di codici a barre standard, il test progettato è molto più veloce, meno laborioso e quindi molto più economico. Dopo solo 2 ore di PCR e successiva analisi HRM, i risultati sono disponibili. Inoltre, i brevi prodotti di amplificazione facilitano l'analisi del DNA degradato, come spesso è presente nel materiale finemente polverizzato. Marieschi et al. (2012) hanno sviluppato marcatori di regione amplificata caratterizzata da sequenza (SCAR) per la discriminazione dello zafferano da diversi adulteranti (tra cui C. officinalis) e sono stati in grado di rilevare adulterazioni di appena l'1%. Jiang et al. (2014) ha riportato un'analisi della curva di fusione di un codice a barre utilizzando general psbA-trnH primer per lo stesso scopo. In base alla loro metodologia e ai risultati (picchi ampiamente sovrapposti di Calendula e zafferano), supponiamo che il limite di rilevabilità di Calendula adulterazioni è notevolmente superiore all'1%. Entrambi i test non sono stati testati per la specie-specificità di C. officinalis.

Lo scopo di questo studio era sviluppare un test basato sul DNA per identificare la pianta economicamente importante C. officinalis e per distinguerlo dalle altre specie del genere. L'analisi dei campioni outgroup dovrebbe dimostrare la specificità del dosaggio e migliorare l'affidabilità dei risultati. Diverse specie outgroup crescono spontaneamente nell'Europa centrale e sono quindi potenziali contaminanti come "erbacce", ma non sono segnalate adulterazioni frequenti. Inoltre, abbiamo verificato se il test è in grado di rilevare C. officinalis come adulterante in campioni di zafferano.


Astratto

L'analisi di fusione ad alta risoluzione (HRM) è una tecnica a tubo chiuso, rapida e sensibile in grado di rilevare le variazioni del DNA. Si basa sulle curve di fusione della fluorescenza che si ottengono dalla transizione del DNA a doppio filamento (dsDNA) al DNA a singolo filamento (ssDNA) a seguito dell'aumento della temperatura. In questo studio, abbiamo valutato l'efficacia dell'HRM come strumento per genotipizzare in modo rapido e preciso popolazioni di Symbiodinium monotipiche utilizzando lo spaziatore trascritto interno, regione 2, DNA ribosomiale (ITS2 rDNA). Per questo, i profili di elettroforesi su gel a gradiente denaturante Symbiodinium (DGGE), in cui le bande di gel sono state asportate e sequenziate, sono stati confrontati con i genotipi HRM. I risultati hanno mostrato che venti colture sono state genotipizzate correttamente in <2 h utilizzando l'analisi HRM con una percentuale di confidenza >90%. Sono stati inoltre studiati i limiti della tecnica. A differenza di altre tecniche utilizzate per la genotipizzazione di Symbiodinium, come DGGE e altri profili di impronte digitali, l'HRM è una tecnica di grande vantaggio per gli ecologi ei fisiologi della barriera corallina sul campo poiché non è richiesta alcuna competenza in metodi molecolari avanzati.


Astratto

L'analisi di fusione ad alta risoluzione (HRM) si basa sull'uso di coloranti fluorescenti, come LCGreen, ResoLight e SYTO9, che si legano in modo saturato ai DNA a doppio filamento. Questi coloranti sono costosi in uso e potrebbero non essere convenienti quando si tratta di una grande quantità di campioni. EvaGreen è un colorante intercalante dell'elica del DNA molto più economico ed è stato utilizzato nella reazione a catena della polimerasi (PCR) quantitativa in tempo reale e nell'analisi della curva di fusione del DNA post-PCR. Qui riportiamo lo sviluppo di un'analisi HRM basata su EvaGreen e le sue prestazioni, rispetto alla popolare analisi HRM basata su LCGreen, nel rilevamento del polimorfismo del DNA nelle piante. Abbiamo scoperto che vari polimorfismi che variavano da polimorfismi a singolo nucleotide (SNP) a Indels sono stati ugualmente rilevati utilizzando HRM basato su EvaGreen o LCGreen. Il colorante EvaGreen è stato abbastanza sensibile nella scoperta di SNP in campioni raggruppati di cinque volte. Usando questo colorante economico abbiamo identificato con successo più nuovi alleli mutanti di Gln1-3 gene, che produce un isoenzima citosolico della glutammina sintetasi (GS1), in una libreria mutagenizzata di etilmetansolfonato (EMS) di mais e popolazioni di mappatura del riso genotipizzate con marcatori SNP. I risultati attuali suggeriscono che EvaGreen è un colorante promettente per l'analisi HRM per la sua facilità d'uso e l'economicità.


Supporto per lo spostamento termico delle proteine—Risoluzione dei problemi

Ottimizza i tuoi esperimenti per ottenere i migliori risultati. Abbiamo compilato una base di conoscenza dettagliata dei migliori suggerimenti e trucchi per soddisfare le tue esigenze di ricerca.

Visualizza le domande pertinenti di seguito:

All'inizio del tuo esperimento? Visita il nostro

È possibile seguire questa procedura come descritto nel documento seguente. Lo strumento di analisi presente nella pubblicazione è disponibile a questo link.

I tamponi influiscono sul legame di un ligando e di solito è meglio scegliere un tampone che aumenti la Tm. Inoltre, è necessario considerare quale tampone è più rappresentativo dell'ambiente in cui esisterebbero la proteina e il ligando (ad esempio sangue, plasma, ecc.). Si consiglia di provare alcune condizioni tampone, poiché la tecnologia Protein Thermal Shift™ favorisce lo screening di molte condizioni in un breve lasso di tempo.

Scegli "Esegui metodo" nella scheda "Configurazione" sul lato sinistro del software ViiA™ 7. Scegli la scheda "Filtri ottici" e verrà mostrata un'opzione per scegliere il filtro di eccitazione e di emissione. Seleziona la combinazione di filtri X1-M3.

È importante che la raccolta dei dati sia attivata per la porzione di rampa della curva di fusione. Vedere un esempio di metodo di esecuzione di seguito, notando lo stato delle icone di raccolta dati.

Raccomandiamo 3-4 repliche tecniche e la diffusione della Tm delle repliche dipenderà dalla sensibilità della proteina alla manipolazione. Un buon set di replicati avrà un intervallo di <0.5°C, con <0.1°C per la maggior parte delle proteine ​​ben educate.

Il software Protein Thermal Shift™ accetterà e analizzerà solo file di dati (*.eds) generati da strumenti compatibili Applied Biosystems® Real-Time PCR (QuantStudio®, ViiA™ 7, 7500/7500F (con SDS v2.0.x), o i sistemi StepOne™/StepOnePlus™).

Il Boltzmann è un modello a due parametri per la transizione tra i due stati (cioè le configurazioni nativa e spiegata della proteina). L'equazione di Boltzmann è una curva sigmoidale a due stati. La regione iniziale e finale dovrebbe essere scelta in modo tale che il segnale intermedio assomigli al meglio a un profilo sigmoidale. Quindi l'inizio dovrebbe essere dove il segnale è ancora relativamente piatto e la fine dovrebbe essere dove il segnale è già salito al suo livello più alto.

Forniamo i due metodi indipendenti perché ognuno ha cose uniche da offrire in termini di analisi. Il modello di Boltzmann a due stati ha un significato e un fascino fisici. Fornisce anche un ottimo modo per normalizzare le ondulazioni rumorose nel segnale. Tuttavia, quelle ondulazioni possono essere di interesse effettivo e non rumore, come per le proteine ​​multidominio dove possono corrispondere a domini diversi che si separano in fasi. Qui il modello dei due stati è inappropriato. Il metodo derivato può aiutare a ottenere una temperatura alla quale si verificano i picchi locali. Questi sono due approcci completamente indipendenti. Se il modello a due stati si adatta perfettamente ai tuoi dati, i risultati dovrebbero essere in stretto accordo.

Il software consentirà ≥100 piastre per studio. Consentiamo all'utente questa flessibilità, ma non consigliamo di mescolare i dati di più piastre a meno che non abbiano convalidato i risultati in anticipo. Come minimo, raccomandiamo ai ricercatori di includere un test di riferimento in ogni piastra per garantire la riproducibilità.

L'elevato rumore di fondo può derivare da diverse variabili. Una serie di controlli adeguati può restringere le possibili cause, che possono essere utilizzate per trovare la risoluzione appropriata. Di seguito è riportato un elenco di cause comuni di rumore di fondo elevato e una risoluzione del problema quando l'elenco delle possibili cause viene ridotto:

La proteina nativa ha siti idrofobici esterni

Segnale di fondo iniziale elevato e/o un piccolo aumento transitorio del segnale

  • La proteina potrebbe non essere un candidato adatto per gli studi Protein Thermal Shift™.
  • Eseguire studi di titolazione proteine:coloranti per ottimizzare la concentrazione di proteine ​​e il rapporto proteine:coloranti.

La soluzione proteica contiene livelli elevati di detersivo (>0.02%)

Segnale di fondo iniziale alto

Alta fluorescenza nei pozzi NPC

  • Eseguire studi di titolazione proteine:coloranti per ottimizzare la concentrazione di proteine ​​e il rapporto proteine:coloranti.
  • Ripurificare la proteina utilizzando un metodo di precipitazione solfato di ammonio. Risolubilizzare la proteina purificata utilizzando il tampone HEPES o un tampone a pH neutro, quindi aggiungere glicerolo e DTT.

Il componente tampone interagisce con il colorante

Segnale di fondo iniziale alto

Alta fluorescenza nei pozzi NPC

Elevata fluorescenza nei pozzi LOC

  • Eseguire studi di titolazione proteine:coloranti per ottimizzare la concentrazione di proteine ​​e il rapporto proteine:coloranti.
  • Eseguire uno studio di screening del tampone Protein Thermal Shift™ per identificare condizioni tampone alternative.

Il ligando interagisce con il colorante

Segnale di fondo iniziale alto

Elevata fluorescenza nei pozzi LOC

Utilizzare un metodo alternativo per lo screening delle condizioni che influiscono sulla stabilità termica della proteina.


Guarda il video: I metodi di fusione 1 - Anteprima (Agosto 2022).