Informazione

Come possiamo creare un dinosauro vivente usando la tecnologia del DNA?

Come possiamo creare un dinosauro vivente usando la tecnologia del DNA?



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Mi chiedo cosa dovremmo fare per creare un dinosauro vivente usando la tecnologia del DNA? Se non è possibile con la tecnologia attuale, sarà mai fattibile?

Nel film Jurassic Park, gli scienziati estraggono il DNA di dinosauro da una zanzara che è stata conservata nell'ambra e che ha succhiato il sangue da un dinosauro. Il DNA è incompleto, quindi gli scienziati lo uniscono con il DNA di rana. Il DNA viene quindi inserito in un uovo di coccodrillo e viene creato un embrione, e così via.

Il metodo Jurrassic Park è dubbio. Sebbene il DNA di dinosauro sia stato trovato e isolato, era troppo danneggiato per riportarlo alla sua forma originale usando la tecnologia attuale. Non è chiaro se lo splicing con il DNA di rana funzionerebbe. Dimentichiamo per il momento come si farebbe sviluppare l'embrione di dinosauro e le uova da incubare e schiudere. Voglio sapere come potremmo sequenziare completamente il genoma di qualche dinosauro?


È ampiamente accettato che gli uccelli sono infatti dinosauri. Cladisticamente parlando, non è necessaria alcuna tecnologia del DNA per creare un dinosauro vivente, poiché esistono già.

Supponendo che tu voglia fare lo stesso con a non aviario dinosauro (un gruppo parafiletico), tuttavia, un'idea migliore sarebbe chiedere su World Building SE, poiché ci sono state poche o nessuna ricerca scientifica sull'argomento e le risposte speculative sono generalmente considerate fuori tema qui.


Il confronto con il DNA correlato è come è stato fatto in passato con il mammut lanoso. Quindi potrebbe essere questione di estrarre abbastanza e trovare parenti abbastanza stretti per farlo. Ma da quello che ho letto, il DNA è così fortemente frammentato che è relativamente impossibile mappare anche i parenti stretti. Puoi capire questo perché più il DNA è fortemente frammentato, più piccoli sono i pezzi. Quindi se hai un filo come questo:

ACTGATCGTACGTAGCTAGCTAGCTAGCTAGCTAGCTAGCTAGCTACTACTAGCT

È lungo e può mappare solo una o due posizioni sul genoma di un parente. Ma se hai fili fortemente frammentati che sono molto più corti come questo:

AGTC

Puoi immaginare che sarebbe mappato a milioni di posizioni diverse. Quindi metterli in ordine sarebbe essenzialmente impossibile.

Dobbiamo anche mettere queste cose su una linea temporale per capire davvero la difficoltà, i mammut lanosi vivevano 500.000 anni fa, i dinosauri erano come 60 milioni di anni fa.


Come fare un dinosauro

PASSO 1)Trova un pezzo di ambra con intrappolato un insetto succhiasangue dell'era dei dinosauri.

PASSO 2)Estrai il sangue che l'insetto ha succhiato da un dinosauro.

FASE 3)Usa il codice genetico del dinosauro (DNA) trovato nel sangue come progetto per un altro dinosauro. Se mancano pezzi del DNA, riempi gli spazi vuoti con DNA di rana.

FASE 4)Usa queste stampe blu per creare un uovo di dinosauro.

PASSO 5)Fai schiudere il dinosauro in un'incubatrice.

PASSO 6)Alza il dinosauro a grandezza naturale.

Potremmo davvero usare questa formula per ricreare i dinosauri? Se non possiamo oggi, possiamo ragionevolmente aspettarci che la nostra tecnologia diventi abbastanza buona da poterlo fare in futuro?

Diamo un'occhiata al primo passaggio. L'idea di ottenere il DNA di dinosauro da insetti che mordono intrappolati nell'ambra è nata con George O. Poinar negli anni '80. L'ambra è linfa d'albero fossilizzata. Di solito è chiaro con una sfumatura giallastra. A volte gli insetti rimangono intrappolati nella linfa degli alberi prima che si induriscano. Alcune date dell'ambra risalgono all'era mesozoica quando vivevano i dinosauri e non è impossibile che gli insetti, che trasportano sangue di dinosauro, possano essere intrappolati nell'ambra. Il primo passo sembra a posto se siamo disposti a spendere tempo e denaro per cercare i giusti pezzi di ambra.

L'ambra è estremamente utile per la ricerca sul DNA antico. Nella maggior parte delle ossa fossilizzate il materiale organico vero e proprio è stato sostituito da minerali. Tuttavia, l'ambra conserva i tessuti molli di un animale per lunghi periodi di tempo.

Il secondo passo è rimuovere il DNA del dinosauro dall'insetto. Il DNA, spesso chiamato il progetto della vita, si trova in molte cellule di un corpo vivente. I laboratori di polizia hanno effettivamente estratto il DNA umano dalle moderne zanzare da utilizzare come prova in casi criminali. Quindi, anche se potrebbe essere estremamente difficile, non è impossibile che potremmo essere in grado di estrarre alcuni dino DNA dai globuli bianchi nel sangue che recuperiamo da un'antica zanzara (Sarebbe molto più facile da fare se potessimo ottenere il DNA dai globuli rossi poiché ce ne sono molti di più nel sangue rispetto ai globuli bianchi, ma purtroppo i globuli rossi non portano DNA).

Dopo di che, però, ci troviamo nei guai. Gli scienziati hanno già estratto frammenti di DNA da un punteruolo estinto che è stato intrappolato nell'ambra da 120 a 135 milioni di anni fa. Nota che era solo un frammento di DNA del punteruolo (meno di un milionesimo dell'intera sequenza), e non il sangue di qualcosa che ha morso.

Un set completo di DNA porta le impronte blu della creatura di cui fa parte. Tuttavia, questo codice è composto da miliardi di singole "coppie di basi" (come le lettere di un alfabeto) e l'ordine di queste è molto importante per il codice. Il DNA è relativamente fragile e si rompe nel tempo. Il DNA che probabilmente recupereremo dallo stomaco di un insetto si sarà disintegrato in minuscoli pezzi e la maggior parte di esso mancherà. Sfortunatamente non possiamo semplicemente sostituire la sezione mancante con il DNA di rana. Se lo facessimo, ci ritroveremmo con DNA di rana con alcune minuscole sezioni di dinosauro piuttosto che DNA di dinosauro con poche sezioni di rana.

Sarà difficile per gli scienziati essere sicuri di avere un frammento di DNA di dinosauro e non una parte dell'insetto o una contaminazione da qualcosa sotto le unghie dei ricercatori. Ricorda che nessuno ha mai visto il DNA di un dinosauro prima d'ora, quindi possiamo identificarlo solo confrontandolo e confrontandolo con il DNA di animali vivi oggi.

Se dovessimo riempire la sezione mancante del DNA di dinosauro, sarebbe più logico prenderlo in prestito dagli uccelli poiché sembrano essere le creature viventi più vicine a un dinosauro.

Quando raggiungiamo il Terzo Livello, le cose si fanno davvero difficili. Il DNA è spesso paragonato a un programma software su un computer perché contiene istruzioni su come costruire una creatura vivente. (Mentre le istruzioni in un programma per computer potrebbero dire alla macchina come fare le tasse.) Per fare qualcosa su un computer, però, è necessario non solo il software, ma l'hardware (il computer stesso) per eseguirlo. Allo stesso modo, ci manca l'"hardware" necessario per eseguire il DNA. Questo sarebbe normalmente un dinosauro mamma che produce un uovo con il DNA in esso. Sfortunatamente non qualsiasi vecchio uovo di gallina lo farà. Ci serve un uovo di dinosauro. Probabilmente uno della stessa specie che stiamo cercando di duplicare. Potremmo alterare qualcosa come un uovo di struzzo per questo scopo? Forse, ma oggi non sappiamo come farlo, né che tipo di cambiamenti sono necessari.

Supponendo di trovare un modo per superare questo ostacolo, qual è il prossimo passo? Covare il dinosauro in un'incubatrice. Di questo abbiamo molta esperienza. Se le uova sono buone, probabilmente possiamo farle schiudere.

Ora dobbiamo allevare i nostri cuccioli di dinosauro fino all'età adulta. La nostra esperienza con l'allevamento di altre specie aiuterà. I condor della California in cattività sono stati allevati usando pupazzi per recitare le parti dei genitori. In questo modo non si sono sentiti troppo a loro agio con gli esseri umani e il passaggio a vivere da soli nella natura è stato facilitato. La logistica di fornire un fantoccio Apatasaurs lungo ottanta piedi per questo scopo potrebbe essere difficile, ma non insormontabile.

Tuttavia, dovremmo essere preoccupati per la salute del nostro dinosauro. Cosa gli alimentiamo? Molte delle piante che ha mangiato nel Mesozoico si estingueranno. Che tipo di nuovi germi si sono sviluppati negli ultimi 65 milioni di anni a cui il nostro dinosauro non ha resistenza? Che tipo di medicina possiamo dare al nostro dinosauro se si ammala? Senza una storia passata del comportamento dei dinosauri su cui lavorare sarà difficile dire se il nostro dinosauro si comporta "normalmente" o meno.

Anche se non saremo mai in grado di costruire un dinosauro da DNA fossilizzato, gli scienziati possono ancora imparare molto su queste creature e sulla vita in generale studiando sezioni del DNA antico per vedere come è cambiato nel corso dei secoli.

E chi lo sa? Se riusciamo a superare tutti questi ostacoli, forse un giorno potremo costruire un dinosauro. Nel frattempo, finché non lo faremo, dovremo accontentarci di vederli nei film.

L'ambra potrebbe rivelarsi non essere l'unica potenziale fonte di DNA di dinosauro. Sebbene la maggior parte delle ossa fossilizzate non contenga più alcun materiale biologico, ci sono forse rari casi in cui il materiale organico è sopravvissuto al processo di fossilizzazione. Scott Woodward, della Brigham Young University, ha riferito di aver trovato DNA in ossa recuperate da una miniera di carbone sotterranea.

Woodward sapeva che le carcasse trovate nelle torbiere erano spesso ben conservate per lunghi periodi di tempo. Sapeva anche che le antiche torbiere diventavano moderne vene di carbone. Recuperando alcuni frammenti ossei trovati in una miniera di carbone, Woodward ha deciso di cercare il DNA.

Come Woodward aveva sperato, l'osso non era completamente fossilizzato e le porzioni erano "cerose, come sapone duro". L'esame microscopico dell'osso mostrò che le strutture cellulari erano ancora conservate, così iniziò a cercare il DNA.

È stato trovato un segmento genico, lungo 174 paia di basi. Non sembrava lo stesso gene di nessun animale vivente, una forte indicazione che non era il risultato di una contaminazione di laboratorio.

Un frammento di osso di dinosauro. (Copyright Lee Krystek 1996)

Sebbene Woodward non possa dire con certezza che i frammenti ossei trovati nel carbone provenissero da un particolare dinosauro, sa che qualunque animale fosse grande e visse circa 80 milioni di anni fa durante il Certaceo. Un dinosauro sembra un buon candidato.

Se Woodward può dimostrare di avere un DNA di dinosauro, la sua tecnica potrebbe essere estremamente utile per saperne di più sulle creature estinte. A differenza degli insetti nell'ambra, ottenere il DNA direttamente dall'osso di dinosauro consentirebbe di associare specifiche sequenze di DNA a specifiche specie di dinosauri.

Paleontologo Jack Horner e studente laureato Mary Schwietzer aveva già cercato di isolareTirannosauro Rex DNA dalle ossa anche prima che Woodward iniziasse il suo lavoro.

Mentre ottenere il DNA dai dinosauri è difficile, recuperarlo da specie estinte più di recente può essere abbastanza facile. Hendrik Polinar dell'Università di Monaco è riuscito a identificare un bradipo gigante dal DNA negli escrementi delle dimensioni di una palla da softball della creatura. Lo sterco è stato lasciato in una grotta vicino a Las Vegas circa 20.000 anni fa. Nel momento in cui il DNA si è "caramellato" quando le molecole di proteine ​​e zucchero si sono intrecciate. Questo proteggeva il DNA dal decadimento. Polinar è stato in grado in seguito di dividere i legami e leggere le sequenze genetiche. Nonostante la conservazione, gran parte del materiale del DNA era ancora perduto, e sembra improbabile che questo processo possa essere utilizzato per creare un bradipo gigante per un "Jurassic Park".


Arrivano i Dino-Polli

Alcuni anni fa Bhart-Anjan Bhullar, poi un dottorato di ricerca. studente nel laboratorio di Arhat Abzhanov ad Harvard, ha fatto qualcosa di piuttosto incredibile: ha preso un pollo embrionale e ha inibito un paio di geni durante il suo sviluppo. È stato un piccolo aggiustamento che ha prodotto un risultato piuttosto sorprendente: "Quei polli che sono stati modificati in quel modo, sono cresciuti con un muso che sembrava quello di un dinosauro", dice Inverso.

La ricerca di Bhullar esiste nella strana intersezione tra biologia molecolare e paleontologia. Quando non insegna a Yale, sta indagando su come sono nate le principali caratteristiche distintive dei gruppi animali, in questo caso il becco dell'uccello. Potrebbe non sembrare un grosso problema, ma capire come è nato il becco dell'uccello è incredibilmente fondamentale per capire non solo come si sono evoluti gli animali moderni, ma anche per capire i dinosauri che prima vagavano per la Terra - e quali animali potrebbero poi vagare su questo pianeta.

Per essere chiari, Bhullar non è esattamente provare per decodificare un dinosauro da un pollo. Eppure, secondo i suoi calcoli, tra 15 o 20 anni avremo tutti gli strumenti e le informazioni necessari per covare un dino-pollo vivo, che respira, che corre in giro a catturare la preda nel suo muso dentato come un piccolo velociraptor. "Questo non è teorico", dice. “Non sto parlando di mezzo secolo qui, sto parlando di decenni. Succederà".

Gli uccelli non sono solo i parenti viventi più stretti dei dinosauri: loro sono dinosauri. Il termine "dinosauro" definisce un gruppo molto ampio di animali con un'enorme diversità di tratti che discendono tutti da un antenato comune e hanno governato il mondo per molti milioni di anni. Una breve lezione di storia: dopo l'impatto con l'asteroide, quasi tutti si sono estinti. Ma non tutti. Alcuni dinosauri - piccole cose con ali, piume e becchi - se la sono cavata bene, e da loro, oltre 65 milioni di anni, sono emerse le 20.000 specie di uccelli che oggi chiamano il Pianeta Terra. Se potessi rintracciare la discendenza genetica di un pollo abbastanza indietro, otterresti che assomiglia molto ai dinosauri dei nostri reperti fossili e della nostra immaginazione.

"I segreti della storia degli esseri viventi sono ancora rinchiusi nella sua eredità, e in particolare nel genoma", afferma Bhullar. Non è che tutte le informazioni genetiche del lontano antenato del pollo siano ancora nascoste nel suo DNA, ma molte lo sono, o almeno potenzialmente lo sono.

In particolare, i vertebrati tendono ad evolversi in modo molto sottile nel tempo, spiega Bhullar. "Ci sono solo alcune variazioni nell'anatomia che i vertebrati producono, ed è probabilmente perché siamo così intricati, siamo così complessi, che rovinare qualcosa in anticipo non produrrà facilmente un essere vivente vitale".

A livello di sviluppo molecolare, la differenza tra il becco di un uccello e il muso di un dinosauro è piccola: è sufficiente modificare leggermente l'espressione di alcuni geni in un embrione in via di sviluppo per crearne uno piuttosto che l'altro. Il becco, a quanto pare, è un adattamento super cresciuto della premascella, un paio di minuscole ossa che si trovano nella parte anteriore del viso e ospitano gli incisivi.

Circa 85 milioni di anni fa, un ramo dell'albero genealogico dei dinosauri aveva praticamente già capito il piano del corpo dell'uccello. Questi erano piccoli teropodi carnivori, imparentati con Velociraptor e tirannosauro Rex. Avevano piume, ali, corpi simili a uccelli e cervelli simili a uccelli. Potrebbero volare. Ma avevano ancora piccoli musi di dinosauro dentati. Il famoso Archaeopteryx è un buon esempio.

Poi, all'improvviso, almeno dal punto di vista geologico, sono comparsi i primi becchi. Quegli animali di transizione avevano ancora le mascelle dentate, tranne che con un becco davanti, come se fosse stato incollato, spiega Bhullar.

Passarono milioni di anni, i dinosauri dalla linea di uccelli persero i denti e le loro ossa mascellari si ridussero praticamente a nulla. Rimangono con nient'altro che un grande becco che suona il clacson. Ma quel grande becco che suonava il clacson, a quanto pare, era proprio ciò di cui avevano bisogno per sopravvivere all'apocalisse.

"Le cose che sono sopravvissute alla fine del Cretaceo, nel complesso, erano cose che erano in grado di utilizzare fonti di cibo come semi, insetti e altri tipi di nutrimento che sarebbero stati disponibili in un mondo post-cataclisma", afferma Bhullar. “E il modo in cui funziona il becco consente un'acquisizione rapida e precisa di piccoli alimenti su uno sfondo molto complicato. Puoi immaginare di camminare lungo i detriti di una foresta distrutta, e ci sono solo ciottoli, cenere e ogni tipo di merda per terra, e devi scegliere, con i tuoi occhi da Grande Uccello e il tuo cervello da Grande Uccello, i piccoli frammenti di cose che sono effettivamente commestibili”.

Vale la pena notare che quelle altre forme di dinosauri simili a uccelli - quelli con il muso dentato e quelli con il muso/becco ibrido - erano ancora in giro e stavano bene quando l'asteroide ha fatto un buco nella crosta terrestre. Ma nessuno di loro è uscito dall'altra parte. "Tutte le cose che non avevano un becco completamente moderno sono morte e molte cose, indipendentemente, che avevano il moderno becco d'uccello, sono sopravvissute", dice Bhullar.

Perché esattamente ai dinosauri siano cresciuti i primi becchi 85 milioni di anni fa, è difficile da dire. Ma Bhullar pensa che abbia qualcosa a che fare con le mani. I teropodi come il velociraptor avevano lunghe mani di dinosauro artigliate con cui strappare la preda. "Quelle mani giganti sono l'impalcatura su cui è stata costruita l'ala dell'uccello", dice, e alla fine anche le mani e le dita sono state perse, a favore di un volo più efficiente.

Fu in quel preciso momento evolutivo che apparvero i becchi, dice Bhullar. Se hai mai visto un corvo usare il suo becco per manipolare uno strumento, non è difficile vedere come lo strumento di precisione del becco potrebbe aiutare a sostituire lo strumento di precisione di un paio di mani.

La domanda "Cos'è un becco?" è il punto di partenza per capire da dove vengono e come, a livello molecolare, i geni agiscono su un embrione in via di sviluppo per crearne uno. E da lì, un becco può essere annullato.

Bhullar non ha mai covato i suoi polli dal muso di dinosauro, perché l'obiettivo dell'esperimento era indagare sui percorsi di sviluppo, non vedere se queste creature mutanti potessero covare, respirare, mangiare e camminare. Sono stati eliminati quando i loro crani sono stati sviluppati abbastanza all'interno del guscio per verificare che sì, le loro teste sembravano piccole teste di dinosauro.

Per la cronaca, però, Bhullar pensa che se la sarebbero cavata bene. "Tutto sembrava organizzato, non sembrava super incasinato o deformato, erano solo trasformati".

Non ci vorrebbero troppe di queste piccole modifiche per passare da un pollo a qualcosa che sembra molto più dinosauro, dice. E abbiamo la tecnologia per farlo oggi. L'unico intoppo è capire quali piccoli frammenti di codice genetico devono essere scambiati e sostituiti.

"Stiamo parlando di utilizzare le risorse esistenti e le risorse esistenti per farlo, e l'unica cosa che in realtà ci limita è la nostra comprensione scientifica di base di quali parti del genoma stanno realmente controllando questi cambiamenti. Se qualcuno venisse dal futuro e ci desse letteralmente un documento Word - probabilmente dovrebbe essere lungo solo due pagine - con un elenco di tratti del genoma da scambiare tra alligatore e uccello, saremmo d'oro. Potremmo farlo subito".

Con cosa esattamente scambiare quelle sezioni sarebbe una questione di sperimentazione. Potresti usare un alligatore o un coccodrillo, i parenti più stretti di uccelli e dinosauri. Potresti anche usare un software per computer per ricostruire digitalmente il genoma dell'ultimo antenato comune di uccelli e coccodrilli e usarlo per il tuo DNA sostitutivo.

Tutto questo può avvenire grazie a una recente tecnologia chiamata CRISPR, che permette di modificare i genomi a un livello molto fine inserendo, rimuovendo o sostituendo piccoli segmenti. Nel racconto di Bhullar, è "assolutamente trasformativo, l'hype è reale - CRISPR è incredibile".

Certo, ma ecco il punto: non siamo molto lontani da un mondo in cui possiamo sintetizzare interi genomi da zero. Ed è allora che le cose diventeranno ancora più strane. Quel genoma ricostruito per l'antenato comune di un uccello e un coccodrillo? Potremmo fare quella cosa. Bhullar sta lavorando su un fossile di un primo antenato di un coccodrillo in questo momento che sembra un piccolo dinosauro predatore terrestre costruito come un levriero - potrebbe finire in qualcosa del genere.

"Oppure, usando il software comparativo che abbiamo per esaminare i genomi, potresti dire: 'OK, prima ricostruisci la forma ancestrale, ma poi sollevala per renderla un po' più simile al lato dell'uccello.' Quindi tu' è una specie di salire sull'albero verso gli uccelli, che è fondamentalmente come attraversare l'evoluzione dei dinosauri", dice. "Scommetto che alla fine diventeresti un piccolo, tipo, velociraptor."

Anche se potessimo sintetizzare i genomi nella loro interezza, non possiamo semplicemente costruire un T. rex, dal momento che non abbiamo alcun DNA di dinosauro conservato. Nonostante cosa Jurassic Park vorresti credere che il materiale genetico non si conserva molto bene oltre i 65 milioni di anni.

Ma creature estinte più di recente? Potremmo farli. “Abbiamo il genoma di Neanderthal che è incredibile. Abbiamo il genoma gigantesco che è sbalorditivo", afferma Bhullar. "Qualcuno riporterà sicuramente in vita i Neanderthal e sarà super interessante, e all'improvviso avremo due specie di umani sulla Terra".

Ovviamente, le considerazioni etiche di fare tutto questo sono piuttosto pesanti, motivo per cui Bhullar, per ora, si accontenta di vivere nel mondo della scienza di base, dove gli embrioni di pollo senza becco possono svilupparsi solo al punto necessario per verificare l'ipotesi .

"Non è qualcosa su cui voglio saltare, eppure, questo accadrà, l'era degli organismi di design è alle porte", dice. “Preferirei fare il mio lavoro basato sulla scoperta e capire il mondo e cambiarlo aumentando la conoscenza delle persone e la soddisfazione delle persone per le loro vite, e si spera che la loro compassione e la loro comprensione, più di quanto vorrei cambiarlo rilasciando tutto questo geneticamente organismi modificati”.

"Il futuro sarà davvero interessante e ci saranno molte domande che le persone dovranno porsi e molte domande che non hanno risposte ovvie".


L'Istituto per la ricerca sulla creazione

Trovare il DNA di un dinosauro è impensabile per un evoluzionista quanto lo sarebbe per un geografo trovare una terra piatta. Questo perché il DNA decade troppo rapidamente per durare milioni di anni. Pertanto, un recente rapporto su un possibile DNA di dinosauro promette di incontrare la resistenza degli scienziati laici. Ma combinato con nuovi dati sul decadimento del DNA, crea un forte argomento contro il tempo evolutivo.

Gli esperti di fossili hanno studiato a lungo i tessuti e le sostanze biochimiche originali dei dinosauri. Quando le ossa di tirannosauro e adrosauro del Montana sono state osservate al microscopio, si è scoperto che ospitano cellule ossee dall'aspetto fresco chiamate osteociti. I ricercatori hanno persino verificato nel 2009 proteine ​​originali, non mineralizzate e di dinosauro chiamate collagene ed elastina. 1

Il nuovo rapporto sulla rivista Osso identificate proteine ​​specifiche dei vertebrati denominate actina e PHEX. Descriveva anche il DNA nelle cellule dei dinosauri. 2

Molti scienziati laici hanno cercato di risolvere il dilemma delle sostanze biochimiche in rapido decadimento trovate nelle profondità dei fossili affermando che i batteri le hanno prodotte dopo essersi insinuate nell'osso qualche tempo dopo che le creature erano state sepolte in modo catastrofico. Un modo per confutare l'idea dei batteri è trovare esclusivamente proteine ​​animali.

I ricercatori hanno fatto proprio questo. Hanno anche applicato agli osteociti due diversi coloranti sensibili al DNA. Entrambe le macchie hanno visualizzato il DNA in una posizione centrale all'interno delle cellule di dinosauro morte da tempo, dove dovrebbe trovarsi il nucleo della cellula.

Hanno anche applicato un anticorpo che si lega a una proteina di imballaggio del DNA chiamata istone H4. I batteri non hanno l'istone H4, ma i vertebrati sì. L'anticorpo ha legato il suo bersaglio, identificando un altro tipo di proteina originale dei vertebrati. E l'istone si trovava nella stessa regione centrale simile a un nucleo all'interno delle cellule. Le macchie e l'anticorpo non hanno legato altre parti della cellula, né il sedimento che circondava i fossili di dinosauro. In breve, questo studio ha fortemente sostenuto la presenza di proteine ​​e DNA originali dei dinosauri.

Le cellule di dinosauro contengono certamente DNA, e si trova proprio dove ci si aspetterebbe se fosse DNA di dinosauro originale. Senza sequenziare il DNA, è difficile essere assolutamente sicuri. Tuttavia, gli scienziati hanno riportato DNA antico da vari fossili, incluso l'osso di dinosauro. 3

Se è DNA di dinosauro, allora non può avere milioni di anni a causa dei risultati di uno studio separato. Gli scienziati hanno esaminato 158 antiche ossa delle gambe dell'estinto moa gigante che viveva nell'Isola del Sud della Nuova Zelanda. Gli autori dello studio hanno generato un tasso di decadimento del DNA con un rigore senza precedenti. 4

Il team di ricerca moa ha misurato l'emivita del DNA di 521 anni a temperature locali medie. 5 Dopo questo tempo, dovrebbe rimanere solo la metà della quantità di DNA presente quando l'animale è morto. E dopo altri 521 anni, solo la metà di Quello rimane, e così via finché non ne rimane nessuno. A questo ritmo, le molecole di DNA nelle ossa si scompongono dopo soli 10.000 anni in minuscoli segmenti chimici troppo corti per essere sequenziati dalla tecnologia moderna. E questo risultato presuppone fattori di conservazione che ottimizzano la longevità biochimica.

Il DNA non potrebbe durare mezzo milione di anni, ma i paleontologi descrivono il DNA in campioni designati a milioni di anni. Abbandonare il dogma di milioni di anni risolverebbe questo dilemma. Le proteine ​​di dinosauro chiaramente rilevate e quello che sembra il DNA di dinosauro hanno senso se gli strati di terra che le contengono sono stati depositati dal Diluvio di Noè solo migliaia di anni fa.

  1. Schweitzer, M.H. et al. 2009. Caratterizzazione biomolecolare e sequenze proteiche dell'adrosauro campano B. Canadensis. Scienza. 324 (5927): 626-631.
  2. Schweitzer, M.H. et al. 2013 Le analisi molecolari degli osteociti di dinosauro supportano la presenza di molecole endogene. Osso. 52 (1): 414-423.
  3. Woodward, S.R., N.J. Weyand e M. Bunnell. 1994. Sequenza di DNA da frammenti ossei del periodo Cretaceo. Scienza. 266 (5188): 1229-1232.
  4. Allentoft, M.E. et al. 2012 L'emivita del DNA nelle ossa: misurazione della cinetica di decadimento in 158 fossili datati. Atti della Royal Society B. 279 (1748): 4224-4733.
  5. Questa è l'emivita di una regione di 242 bp di DNA mitocondriale moa, calibrata utilizzando anni al radiocarbonio per approssimare gli anni di calendario.

* Mr. Thomas è Science Writer presso l'Institute for Creation Research.

Cita questo articolo: Thomas, B. 2013. DNA in Dinosaur Bones? Atti e fatti. 42 (1): 15.


Ecco perché non possiamo clonare un dinosauro — ma possiamo creare un pollosauro

Visualizza l'immagine a schermo intero
  • commenti Lascia un commento
  • facebook Condividi questo elemento su Facebook
  • whatsapp Condividi questo elemento tramite WhatsApp
  • twitter Condividi questo elemento su Twitter
  • email Invia questa pagina a qualcuno via email
  • altro Condividi questo articolo
  • altro Condividi questo articolo

TORONTO – Con l'apertura di mondo giurassico questa settimana, tutti si chiedono ancora una volta: “Possiamo clonare i dinosauri?” La risposta è facile: no.

Ma c'è dell'altro nella storia oltre alla semplice clonazione.

Il DNA — acido desossiribonucleico — contiene il codice genetico di tutti gli esseri viventi. Il Jurassic Park l'idea è che un'antica zanzara si sia cibata di sangue di dinosauro e poi magari sia rimasta intrappolata nella resina degli alberi, morendo.

Milioni di anni dopo, ci imbattiamo nel sangue di zanzara e dinosauro e poi i genetisti fanno la loro magia per estrarre il DNA dall'ultimo pasto della zanzara e ricostruire il dinosauro che è stato infastidito da detta zanzara (puoi immaginare la frustrazione di un T-rex? avrebbe cercato di scacciare una zanzara?). Il fatto è che è solo questo: magia.

Per non dire che i genetisti non hanno fatto cose incredibili (pensa: la clonazione in generale). È solo che ottenere quel DNA di dinosauro si sta rivelando estremamente difficile.

Gli scienziati hanno effettivamente cercato di estrarre il DNA dalla resina degli alberi. Uno studio del 2013 condotto da ricercatori dell'Università di Manchester ha scoperto che l'estrazione di DNA da insetti conservati in copal (resina dell'albero) di età compresa tra 60 e 10.600 anni, non è riuscita a produrre alcun DNA dagli insetti stessi.

GUARDA: Svelate specie di dinosauri appena scoperte in Alberta

Il problema è che la resina è altamente porosa a livello molecolare, consentendo ai gas di entrare e uscire. Qualsiasi DNA che esistesse una volta sarebbe completamente degradato.

Per quanto riguarda l'estrazione del DNA dai fossili, gli scienziati affermano che anche questo è impossibile poiché il DNA non sopravvive ai processi di fossilizzazione. Le ossa essenzialmente si trasformano in pietra con le sostanze organiche che vengono sostituite con i minerali.

Ma questo non ferma il fascino del pubblico nel riportare queste creature dal passato.

"Qualcuno li ha riassunti come, sono grandi, feroci ed estinti", ha detto Donald Henderson, curatore dei dinosauri al Royal Tyrrell Museum in Alberta. “Quindi sono mostri che sono realmente vissuti, ma sono al sicuro lontano da noi.

E la loro grandezza è forse un'altra ragione.

“Il dinosauro medio è circa 10 volte più grande dell'animale medio di oggi.”

Ma gli scienziati dovrebbero cercare di ricreare animali che si sono estinti? Potrebbero giocare con il fuoco (non è vero?) visto Jurassic Park?)?

"È nella natura di molti pensieri scientifici per alcune persone, che è, se puoi farlo, dovresti provare perché non sai mai cosa ne verrà fuori", ha detto Henderson.

"Ho sempre pensato che ai dinosauri sia stata data una pessima mano", ha detto Hans Larsson, professore alla McGill University e Canada Research Chair in Vertebrate Paleontology. “Penso che non fosse per quell'impatto con l'asteroide, sarebbero ancora oggi gli animali terrestri dominanti.”

Costruire un dinosauro

Si parla di riportare in vita il mammut lanoso, l'ultimo dei quali si ritiene sia morto circa 4.000 anni fa. Gli scienziati sono stati in grado di estrarre il DNA di 43.000 anni dai resti di un mammut lanoso trovato in Siberia nel 2013. Il piano è di unirlo al DNA di un elefante, il parente più prossimo del mammut.

“Sarebbe divertente riportarli indietro. Sono animali così straordinari,' ha detto Henderson. “Riesci a immaginare un elefante gigante e peloso con enormi zanne? Sarebbe piuttosto spettacolare. Forse è la cosa più vicina che avremo mai a riportare in vita i dinosauri

GUARDA: Scoperto il mammut lanoso

Ma per quanto riguarda ottenere il DNA di dinosauro?

“L'idea di trovare il DNA originale e intatto di dinosauri estinti, quella porta è praticamente chiusa

Ma c'è la possibilità di risvegliare i tratti dei dinosauri.

Potresti aver sentito dire che gli uccelli sono antenati dei dinosauri. Ma sono, in effetti, i dinosauri stessi.

“Sappiamo che gli uccelli sono dinosauri,”, disse Larsson.

E si scopre che il pollo è il più vicino a un dinosauro. Così vicino, infatti, che sono in corso ricerche per risvegliare tratti genetici dormienti e antichi per farli sembrare più simili a dinosauri. È chiamato il progetto ‘chickenosaurus’.

“Se lavoriamo con embrioni di pollo e genetica di pollo, stiamo lavorando con embrioni di dinosauro e genetica di dinosauro.

GUARDA: TED talk “Costruire un dinosauro da un pollo”

I genetisti possono manipolare i tratti genetici per sopprimere le piume di un pollo o far ricrescere artigli o scaglie. Per quanto riguarda i denti, risulta che gli uccelli non possono fare lo smalto. Possono creare boccioli di denti, ma questo è tutto. Gli scienziati dovrebbero creare un uccello transgenico, ovvero un uccello con il DNA di un'altra specie, come un topo.

"Non otterresti di nuovo un velociraptor completo, ma potresti ottenere qualcosa che è molto meno uccello e molto più dinosauro estinto", ha detto Larsson.

“Non stiamo davvero parlando di retroingegnerizzazione dei polli per creare dinosauri. In realtà stiamo dicendo che dobbiamo solo progettare un genoma per creare qualcosa che assomigli molto a un dinosauro.

C'è una differenza tra i geni mutanti e il risveglio di tratti dormienti, che si chiama atavismo. E risvegliare tratti atavici non è semplice come premere un interruttore: i geni sono codificati l'uno nell'altro in modo che quando ne manipoli uno, ne influenzerà un altro. Larsson ha detto che è un test costante per vedere le conseguenze dell'attivazione di un tratto. Il suo laboratorio sta lavorando per riattivare l'antica coda del pollo (non è permesso far schiudere il pollo embrionale).

View image in full screen

Larsson said that there are practical applications to being able to create something by altering the genomes, such as the work he and other scientists are doing with the chickenosaurus.

“Imagine taking a corn seed and planting it to grow a house. If we could actually engineer the genome in plants to grow shapes that we find useful, like house-shapes, or furniture shapes,” he said. “None of these are impossible, if we could fully understand how the genome works to create complex anatomy. It’s getting really sci-fi.”

So how long before we see the chickenosaurus?

Larsson said that funding for this kind of research is paltry in both Canada and the United States. In a perfect world, with no limit to funding, he estimates that they could make the chickenosaurus within five years. Instead, with the existing funding, it will take his lab the same time just to figure out the chickenosaurus’s tail.

Mentre Jurassic Park will remain the stuff of science fiction, chin up: there’s still the possibility we’ll create scary-looking monsters developed from chickens.


Understanding the Difference in Cloning and Reverse Engineering

When we are talking about the evolution of dinosaurs, we need not look further than our feathered friends. Birds may not strike the same fear in most that a tyrannosaurus would, but they’re still genetic relatives.

So we have chicken genomes and plenty of DNA to go off of – would it be possible for scientists to manipulate that genetic data and make it closer to a dinosaur than a bird? What if scientists added a long tail, rows of sharp teeth, and more size – would it be a dinosaur?

In terms of looks and functionality, perhaps – it would be as close to a dinosaur as we’ll ever see in the modern age. And even while they have DNA and traits in common, there’s no reason to think it would be the same as cloning a dinosaur.

In that case, it would merely be a creature that was reverse engineered and manipulated to give the appearance of a dinosaur. Because it lacks the true genome of these beasts, it is not the same as being cloned.

Cloning is a tricky concept, especially when we’re dealing with animals that are no longer on the earth anymore. The idea of cloning dinosaurs is possible, but it will require scientists to find the right genetic material.

This is a hard task, as the material is not only in scarce amounts but it is prone to breaking down quickly over time. But the search is on and the goal is in sight.


Risposta

Kat - Now it's time to look at your burning genetics questions, with the help of Naked Scientist Martha Henriques.

Martha - This month, listener Steve Cherry from Lethbridge, Alberta in Canada wanted to know how researchers extract dinosaur DNA from fossils and separate it from contaminant DNA from other organisms. Firstly, the bad news is, that no one has yet successfully isolated DNA from dinosaur fossils. Dr. Greger Larson from Durham University told me how DNA is isolated from fresh biological specimens and why doing the same for ancient specimens like dinosaur remnants is so difficult.

Greger - The way that we usually do it is to simply remove everything that isn't DNA and filter it off and that leaves us with the small tube that only has the DNA left in it. Of course, DNA exists in every single living organism, so we can't discriminate between all the different possible sources of DNA. All we can do is isolate DNA from everything that's non-DNA. And once we've got that in a tube then we can start to do all kinds of things including sequencing it or going after specific markers, or amplifying specific places, but the act of isolating it is a relatively straightforward process and we can do it from any number of things including skin cells or feathers or bone, or teeth, or anything that's biological and that is alive or was recently alive, we can isolate DNA from.

Martha - But when it comes to ancient specimens like dinosaur fossils, the chance of success with this method becomes vanishing small.

Greger - As soon as something dies, everything about that thing starts to degrade. So, the analogy would be, the bowl of fruit that you probably have in your kitchen and if you were just to leave that bowl of fruit there for a day or two, it'll be fine, but if you leave it there for a month, it will probably be no longer something that's even remotely appetizing. And if you leave it there for a year, it would be hard to differentiate the different kinds of fruit you had in that bowl a year before and if you leave it there for 20 years, there probably won't be anything even remotely resembling fruit in there and DNA is no different.

The longer that an organism is dead, the more of the DNA degrades and it degrades at a rate which is dependent upon lots of different factors including how long it's been, what temperature it's being stored at, or what sort of other organisms are eating it, or any number of other things. But even in the best case scenario where you have something frozen say, in the tundra where it's very cold, the half-life of DNA is somewhere in the order of maybe 100 or 200,000 years which means, half of the amount of DNA that you start with will be gone after about 100 and 200,000 years.

So, the reason it's difficult to get DNA out of dinosaur bones is simply because there is no DNA left. The same reason that if you were to leave the bowl of fruit on your kitchen table for 65 million years, the chances of you being able to come back and get any fruit out of that would be virtually nil. So, any reports that there's been of dinosaur DNA, they're either not reporting dinosaur DNA or they're reporting other bits of DNA that they've isolated that don't have anything whatsoever to do with that dinosaur bone.

Martha - This contaminant DNA is a problem for all work on ancient biological specimens. Dr. Mim Bower of Cambridge University worked from isolating DNA from prehistoric horse remains preserved in icy environments. These well-preserved specimens are much younger than dinosaur fossils and still have some of their original DNA present. Dr. Bower describes how she distinguishes any contaminant DNA from the horse DNA that she's interested in.

Mim - So, for every sample of bone that we try to extract DNA out of, we also examine a number of controls so that each time I do a DNA extraction, I work with a set number of 6 control reactions which have exactly the same components in except for the bone particle and that helps me control whether there is a DNA coming from me, or from the environment, or from the reagents that I'm using because if I see a positive DNA peak in my control samples which should have nothing in them then I know that I have made an error somewhere and I go back and I start again, and I'd clean everything down. So, we have a very strict contamination protocol nowadays and I have to say that most DNA researchers who are experienced can work very cleanly. And when we don't work cleanly, we can immediately see what has gone wrong and put it right.

Martha - That was Greger Larson from Durham University and Mim Bower from Cambridge University.


Birds are dinosaurs

The recognition that birds are dinosaurs is an idea that has been proven beyond reasonable doubt in the last 20 years, and also gives us new clues on what extinct dinosaurs might have been like.

Sinosauropteryx was the first dinosaur found to have feathers, other than birds and their immediate relatives. It was covered with simple filament-like feathers, which you can see preserved along the back and tail of this fossil. Scientists have even established that this dinosaur's tail had a striped colour pattern. © Sam Ose and Olai Skjaervoy, licensed under CC BY 2.0, via Flickr

As living dinosaurs, birds can be used to test some of the ideas that palaeontologists have proposed based on bones alone. They also carry a direct genetic legacy of their dinosaurian ancestry, which means that bird genes are dinosaur genes, even though birds represent only one specialised branch of the dinosaur family tree.


L'Istituto per la ricerca sulla creazione

In church, a friend asked me about the movie Jurassic World. Its high-tech presentation makes the idea of scientists resurrecting dinosaurs from DNA &ldquomined&rdquo from fossils almost seem believable. What parts can we trust, and what parts can we toss?

Good science supports about as many of this movie&rsquos major science-sounding concepts as it does those of recent superhero movies&mdashi.e., very few.

First, the movie&rsquos creators seem to have matched giant sauropods to their sizes known from fossils, but real dinosaurs hatched from small eggs and took several dozen years to get that big. Nobody can accelerate a creature&rsquos growth, and there wasn&rsquot enough time for them to achieve that size. Plus, many other dinosaurs appear much larger in the movie than they ever were when alive.

Much of the movie shows unrealistic technology. Geneticists have made incredible discoveries in the last few decades, but with each new detail they uncover, they find another mind-boggling feature of living creatures. Animal anatomies, genetics, and developmental regimes are so complicated we may never understand them well enough to manipulate them like the fictional geneticists in Jurassic World did. The human body accesses over 200 interactive genes involved in height alone. And many of the genes used during embryonic development perform important separate functions later in life, showcasing the awesome ingenuity of our great Creator. Geneticists would not know where to begin manipulating such a vast network of incredible complexity to produce a new type of creature from living animal genes&mdashlet alone an extinct animal like a dinosaur.

Speaking of which, no scientist has yet brought an extinct creature back to life from just its DNA, much less from isolated and degraded fragments of ancient DNA. It takes a mother to make a baby. It would be amazing indeed to make a machine that mimics all the complicated and wonderful features of a mother&rsquos egg and a mother&rsquos body. The opening scene of Jurassic World shows a dinosaur hatching from an already mature egg. They don&rsquot show how that egg got there&mdashwhere&rsquos the required mother? Scientists cannot craft eggs. The mere shell of a dinosaur egg consisted of precisely interwoven protein fibers and minerals thin enough to permit gas exchange but thick enough to protect the baby dinosaur.

Good science can achieve wonderful feats, but it cannot work miracles or magic. It cannot make a baby out of just DNA.

And what about the idea in Jurassic World that iron plus &ldquohydroxyl&rdquo can cause special chemical reactions that somehow preserve animal tissues&mdashand maybe even DNA&mdashfor millions of years? The scriptwriters needed a scientific-sounding basis for asserting that DNA buried in the earth stayed in good enough shape for geneticists to read its stored information even after that length of time. But this iron rescuing device fails for two reasons. First, although iron discourages bacterial growth, iron plus hydroxyl shreds proteins and DNA. In contrast to the assertions about iron&rsquos preserving power, experiments show it destroys tissues. 1 Second, researchers find few signs of iron or hydroxyls when they uncover bone proteins in fossils. Iron can do amazing things like help transport oxygen and conduct electricity, but it cannot halt or reverse the inevitable chemistry involved in the decay of proteins over time.

Jurassic World packs plenty of pure fiction into a literally unbelievable thriller. Here in the real world, incredibly complicated gene networks reveal the Creator&rsquos masterful mind. This fits with Genesis creation. Also, proteins and DNA found in fossils show that Earth&rsquos sedimentary layers are quite young. This fits the Bible&rsquos timeline. IlJurassic World filmmakers did a nice job making science-sounding concepts appear reasonable, but as usual, real science supports Scripture, not fiction.

  1. &ldquoDue to its strong reactivity with biomolecules, hydroxyl radical is capable of doing more damage to biological systems than any other ROS [reactive oxygen species].&rdquo Prousek, J. 2007. Fenton chemistry in biology and in medicine. Pure & Applied Chemistry. 79 (12): 2325&ndash2338.

Image credit: Copyright © 2015 Jurassic World Universe. Adapted for use in accordance with federal copyright (fair use doctrine) law. Usage by ICR does not imply endorsement of copyright holders.

* Mr. Thomas is Science Writer at the Institute for Creation Research.


Jurassic World science: can we clone dinosaurs?

Genetic engineers are working to restore extinct species to life, but doing so involves solving a massive jigsaw puzzle with missing pieces.

When he visited the George Poinar's lab in the 1980s, author Michael Crichton saw a way to lend plausibility to the plot of his novel-in-progress 'Jurassic Park'. Poinar was working to discover whether amber's ability to preserve the tissues of insects and other tiny creatures could also protect the DNA locked away inside the cells of those tissues.

In a case of life imitating art, Poinar gave samples of amber to his son Hendrik who teamed up with Raul Cano of California Polytechnic. Cano had developed and subsequently patented a process for extracting DNA from organisms trapped in the yellow resin. They extracted fragments of DNA from an ancient, stingless bee and then more extensive samples from a weevil that lived 120 million years ago - almost twice as long ago as the cataclysm that wiped out dinosaur species such as Tyrannosaurus rex.

The paper on the recovery of DNA from the weevil appeared in the journal Natura a day after the movie's premiere in Washington DC. It seemed that the idea of bringing long-extinct species back to life might be possible, even if they were only insects.

However, attempts to reproduce the original results failed and realisation dawned that the amber samples were hopelessly contaminated &ndash much of it from the DNA of modern bacteria that had either colonised the samples, or had been picked up in the lab itself. The idea of being able to sequence the DNA of a mosquito trapped in amber millions of years ago, let alone any dinosaur DNA rapidly faded.

Ice-age revival?

But the more stringent lab protocols developed by scientists such as Svante Paabo &ndash together with increasingly sophisticated extraction techniques &ndash have yielded usable ancient DNA from other long-extinct species, including our own Neanderthal relatives.

Ice-age species such as these and mammoths show prospects as good as any for revival. It's not just the relative youth of the fossils that helps. Some people want to go ahead and bring them back in the hope of reviving lost ecosystems.

Stewart Brand, president of The Long Now Foundation and the architect of the group's 'Revive and Restore' project, says: "Because it's cold in the Arctic and sub-Arctic, the DNA is relatively intact."

But ice-age DNA is in far worse condition than any DNA that can be extracted from the living. And all but the most recently extinct species yield DNA that is not in the form of whole chromosomes millions of base pairs long. Beth Shapiro, scientist and author of a recently published book on the practicality of de-extinction, describes it as "more like confetti that's been run over by mammoths in the rain".

Paabo says of the experiments conducted on Neanderthal samples: "The DNA fragments are very, very short. Just 50 or 60 bases. And even the best bones result in just 3 or 4 per cent Neanderthal DNA. The rest are from bacteria that colonise the bones."

Even the constituent bases that make up DNA go through chemical changes as the polymer degrades. Cytosine &ndash the 'C' in the familiar four letter 'GTCA' genetic code &ndash is often changed to uracil. In turn, this leads to errors in sequences, because the biological agents that generate multiple copies of a DNA strand to provide sequencing machines with more raw data miscode uracil, inserting a T for thymine rather than a C. Other chemical changes stop the enzyme that creates DNA copies in its tracks, yielding even less information from the highly fragmented chains.

Chemical error correction has made it possible to recover from many of these problems. But there are still problems for de-extinction proponents. Describing the process used to construct what is, for the moment, the best sequence for Neanderthals, Paabo says: "We sequenced a little over a billion fragments from the DNA recovered from the bones. Parts were missing but in the end we had a little over half the total genome."

Not only is a large portion of the DNA missing, there is no way to determine from the DNA itself how it should be structured in a reconstituted genome. Bioinformatics, biology's IT-oriented arm, can deal with some of the problems. Because individual strands of DNA will break down in different ways, there are often overlapping segments. By comparing these segments, computer software can piece together large parts of the molecular jigsaw puzzle of ancient DNA. By comparing the DNA to the genomes of modern species, it often determines whether they are contaminants. But some parts of the genome are currently beyond our reach for another reason.

Shapiro says: "How many genomes have been completely sequenced? None. Not even our own genome, for which a ridiculous amount has been published."

Missing links

Potentially important missing components are lengths of DNA called heterochromatin. The problem for sequencing heterochromatin is that it is highly repetitive and the repeating sequences are very short. There is no practical way for software, using the data that comes from sequencing machines, to determine how many repetitions there should be because overlaps produce little useful additional information.

The role of heterochromatin is fuzzy, but it seems to have a role in regulating when and where genes are active. As regulation of genes is a key factor in the developing embryo, subtle changes to heterochromatin could result in massive modifications to the organism. Without more information on heterochromatin's role, it is impossible to determine what ancient DNA sequences should even begin to look like. But this need not stop the de-extinction process.

Crichton's other plot element used both for biological plausibility and to deliver the novel's warning &ndash weaving together genes from today's species with those from ancient DNA &ndash may provide the template for de-extinctions in the short to medium term. It is likely to make more sense to start with modern DNA and add in the elements needed to reproduce the ancient species, as the heterochromatin and other poorly understood parts of the genome are already in place. Based on the genomes performed so far, the Asian elephant seems to be a closer relative to the mammoth than the African elephant. This has given geneticists hope that relatively simple changes could result in a surrogate mother elephant giving birth to a baby mammoth. "We could have the first mammoth embryo in three years' time," Brand claims.

George Church's group at Harvard University in Boston, which appears to be in the lead in manipulating elephant DNA to be more mammoth-like, has yet to demonstrate in published research that the genes stitched into elephant eggs result in the mammoth DNA being used even in early development.

But Church's team has developed efficient techniques for editing DNA. Conventional genetic engineering by comparison is hit-and-miss. Church's CRISPR technique makes it possible to insert DNA in a specific part of a chromosome in such a way that the organism is unlikely to reject the addition.

Reverse-engineering DNA to find out how it works is likely to be the only way that dinosaurs &ndash or at least animals that resemble them &ndash could possibly be brought back to life. There are other ways to recover lost DNA information than to sequence the fragments recovered from ancient specimens. A multi-university team realised their chances of finding DNA from a group of species that lived in ice-age South America were remote.

Although a group that included Hendrik Poinar managed to extract DNA from ice-age rodents found in Mexico, the region where these ungulates lived was too warm and wet for even well-preserved specimens to not have their DNA destroyed. But proteins that make up hair and other parts of the body are much more robust. Enzymes insert each amino acid in a protein in the order determined by the DNA sequence of the corresponding gene. Find variations in the proteins and you find how those genes differ from those used by other species. This is also one of the approaches being used by Mary Schweitzer of North Carolina State University, who found remnants of soft tissues and collagen in dinosaur bones. Although the sequences show similarity to bird proteins, they may yet be found to be modern contaminants.

There is another approach. Work has started on uncovering the genetic information that birds discarded over the past 65 million years by, in effect, rewinding their genetic clock. Scientists already think dinosaurs were a lot closer to birds than the giant lizards of popular imagination. In the movies, velociraptors are scaly. A number of fossils have turned up since that give clear indications that the animals were feathered and may even have been able to glide over very short distances.

Turn back the clock

The search for a way back has already begun: with hen's teeth. In 2006, scientists from the University of Wisconsin and the University of Manchester succeeded in coaxing the embryos of chickens to grow teeth similar to those found in dinosaur fossils by reactivating latent genes. Other work, based on the intuition that bird embryos briefly grow lizard-like tails before further development causes them to develop as those of birds, points to a number of individual genes lingering from the days of the dinosaurs that may have mutated very little over millennia because they are still required by the growing organism. Similar work by Richard Borowsky at New York University has given eyes back to blind cavefish, a species that has lost the ability to see since the Pleistocene.

Mutations that render the genes entirely inactive would put the animal itself at risk. What has changed is the framework that puts them to use. By working out ways in which these genes can be reactivated and develop more dinosaur-like features, scientists such as Jack Horner &ndash who acted as consultant on the movie of Crichton's novel &ndash believe it might be possible to reconstruct the creatures by engineering modern bird DNA.

But it's far from clear how much new DNA needs to be synthesised in order to recreate features that have been mutated out completely over millions of years. DNA that is not needed by species quickly turns to junk or is co-opted by other mechanisms in the cell if some of the mutations turn out to be beneficial. Simply rewinding the genetic clock and generating dinosaurs by atavistic mutation of chickens to create what might be called an 'alektosaur' is not a realistic option. De-extinction is likely to need new DNA to be created.

Brand says: "I think it's fair to say this century will be largely defined by intersection between the kind of coding [IT programmers] do and the kind of coding that life does."

But even if radical genetic engineering succeeds in constructing something that looks like a dinosaur, it is clear that it can never bring back what existed more than 65 million years ago. The specific information in those genomes has been chemically shredded forever. Such a chimera would have a lot in common with the beast that underpins the plot of Jurassic World. Maybe life can imitate art.

Sign up to the E&T News e-mail to get great stories like this delivered to your inbox every day.


Guarda il video: Ecco Cosa Successe 10 Minuti Dopo La Scomparsa Dei Dinosauri (Agosto 2022).