Informazione

Differenza di copertura tra ampliconi

Differenza di copertura tra ampliconi



We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Ho 2 file fastq e ho generato un file BAM (indicizzato e ordinato) di alcune letture. Li ho allineati a un genoma di riferimento (hg19).

Sto lavorando con diversi primer.

AVANTI 1. TTGCCAGTTAACGTCTTCCTTCTCTCTCTG 2. CCCTTGTCTCTGTGTTCTTGTCCCCCCCCCA 3. TGATCTGTCCCTCACAGCAGGGTCTTCTCT 4. CACACTGACGTGCCCTCCCTCCCTCCA REVERSE 1. GAGAAAAGGTGGGCCTGAGGTTCAGCCCCACTGAGCTCTGCCTCCCTTAGACCGACCTGCCTTGAGGCCCTCTCCTGCCTTAGAGGCCGACCTGCCTGCCTGCCTTAGACTGCCTTGAGGCCCTCTCCTG

Quindi ho amplificatori diversi. Come posso tracciare la copertura di questi diversi ampliconi. E cosa potrebbe spiegare la grande differenza tra loro?

Grazie mille per il tuo aiuto.


Bene, per tracciare la copertura userei qualcosa come Python Matplotlib. Dai un'occhiata a questo esempio:

import matplotlib.pyplot as plt import matplotlib amplicons = ('TTGCCAGTTAACGTCTTCCTTCTCTCTCTG', 'CCCTTGTCTCTGTGTTCTTGTCCCCCCCA', 'TGATCTGTCCCTCACAGCAGGGTCTTCTCT', 'CACACTGACG,(fig.85) fig. )) subplt = fig.add_subplot(111) subplt.set_ylabel('Count') subplt.set_xlabel('Amplicons') subplt.plot(amplicons, countAmpl, linestyle="-", marker="o", color="blue ") per tl in subplt.get_yticklabels(): tl.set_color('blue') plt.savefig("amplicons.eps")

Controlla altri tipi di grafici in Matplotlib se pensi di aver bisogno di qualcos'altro.

Puoi anche provare ad aprire e visualizzare il BAM in IGV dal Broad Institute.

Per quanto riguarda la differenza di copertura, direi che alcuni provengono da una regione ripetitiva. Oppure la profondità di amplificazione di una regione è maggiore rispetto alle altre. O forse l'allineatore ha trovato regioni simili e ha deciso che l'amplicone si allinea bene in tutte quelle regioni.


BEDTools, tra le altre suite software, ti fornirà un istogramma di copertura. La più grande fonte di bias nell'efficienza della PCR è solo che alcuni primer funzionano meglio di altri, c'è anche un bias di sequenza nella fase di amplificazione della PCR della preparazione della libreria. Il contenuto di GC contribuisce a questo.


Approcci di sequenziamento mirati per NGS

Mentre il sequenziamento dell'intero genoma umano ha fatto avanzare la scoperta e la salute umana, le regioni difficili del genoma sono difficili da analizzare utilizzando questo approccio, con conseguente bias di sequenziamento della popolazione e i database esistenti non sono né completi né accurati (1). Per molte applicazioni di ricerca, il costo del sequenziamento dell'intero genoma può ancora essere un onere, in particolare se si tiene conto dell'elaborazione computazionale e delle esigenze informatiche per l'analisi dell'intero genoma. Questi costi e complessità aggiuntivi sarebbero di scarso beneficio quando si studia una regione specifica di interesse per le malattie e le applicazioni di ricerca traslazionale. Per aiutare a risolvere questo problema, molti ricercatori hanno adottato un approccio di sequenziamento mirato per migliorare la copertura, semplificare l'analisi e l'interpretazione e ridurre i costi totali del flusso di lavoro di sequenziamento.


Innanzitutto, le regioni bersaglio di un genoma o di un campione di DNA vengono amplificate da primer PCR multiplex ben progettati con code sporgenti che sono sequenze adattatrici parziali compatibili con i corrispondenti sequenziatori di DNA, risultando sia in ampliconi bersaglio che in prodotti PCR non specifici inclusi i dimeri di primer.

Tradizionalmente, quando la dimensione del pannello è grande (ad esempio più di 2.000 ampliconi in un singolo pool), i prodotti della PCR non specifici possono essere travolgenti e influenzare in modo significativo le fasi a valle se non vi è alcuna misura per rimuoverli. Alcuni metodi basati su ampliconi utilizzano la purificazione delle perle e la selezione delle dimensioni per rimuovere frammenti di DNA più piccoli come i dimeri di primer. Tuttavia, alcuni prodotti PCR non specifici complicati con dimensioni simili alle lunghezze degli ampliconi target e le relative librerie risultanti possono essere difficili da rimuovere utilizzando solo la selezione delle dimensioni. La seguente traccia del Bioanalyzer mostra un rumore di fondo significativo intorno a una libreria di destinazione di 300 bp.

/>Traccia della libreria CleanPlex senza pulizia dello sfondo

CleanPlex supera questo inconveniente con una fase di pulizia del fondo enzimatica/chimica innovativa e brevettata che rimuove i prodotti PCR non specifici, inclusi sia i dimeri di primer sia gli artefatti PCR non specifici più complicati e più lunghi, risultando in librerie di target molto pure. La seguente traccia di Bioanalyzer mostra l'effetto della tecnologia di pulizia in background CleanPlex.

/>Traccia della libreria CleanPlex con pulizia dello sfondo

Successivamente, i codici a barre dei campioni (a scopo di raggruppamento dei campioni) vengono aggiunti mediante una fase di indicizzazione della PCR per ottenere librerie pronte per il sequenziamento. L'intero flusso di lavoro richiede solo 3 ore e un minimo di tempo pratico.


Valutazione del pannello Precision ID Ancestry

La capacità di fornire informazioni forensi accurate basate sul DNA richiede l'analisi di più marcatori del DNA per prevedere l'ascendenza biogeografica (BGA) e le caratteristiche visibili esternamente (EVC) del donatore di prove biologiche. Il sequenziamento massivo parallelo (MPS) consente l'analisi di centinaia di marcatori di DNA in più campioni contemporaneamente, aumentando il valore dell'intelligenza fornita agli investigatori forensi e riducendo l'esaurimento del materiale probatorio derivante da analisi multiple. Il pannello Precision ID Ancestry (precedentemente HID Ion AmpliSeq™ Ancestry Panel) (Thermo Fisher Scientific) (TFS)) è costituito da 165 SNP autosomici selezionati per dedurre BGA. I criteri di convalida forense sono stati applicati a 95 campioni utilizzando questo pannello per valutare la sensibilità (1 ng-15 pg), la riproducibilità (variabilità tra e intra-serie) e gli effetti di campioni di tipo compromessa e forense (artificialmente degradati e inibiti, di origine mista e campioni di sangue e ossa invecchiati). L'accuratezza della previsione del BGA è stata valutata utilizzando campioni provenienti da individui che hanno autodichiarato i propri antenati come appartenenti a singole popolazioni di origine (n = 36) o da più popolazioni di origine (n = 14). Il sequenziamento è stato condotto su chip Ion 318™ (TFS) sul sistema Ion PGM™ (TFS). Il software HID SNP Genotyper v4.3.1 (TFS) è stato utilizzato per eseguire previsioni BGA basate su proporzioni di commistione (livello continentale) e stime di probabilità (livello di sottopopolazione). La previsione del BGA era accurata a quantità di DNA template di 125 pg e 30 pg usando rispettivamente 21 e 25 cicli di PCR. Le assegnazioni di BGA a livello continentale di HID SNP Genotyper erano concordanti con le BGA per individui autodichiarati dell'Asia orientale, africana, europea e dell'Asia meridionale. Campioni compromessi, di origine mista e misti, oltre alla previsione del livello di sottopopolazione, richiedono un'analisi più ampia.

Questa è un'anteprima del contenuto dell'abbonamento, accedi tramite il tuo istituto.


Astratto

La fenotipizzazione forense può fornire informazioni utili sull'ascendenza biogeografica (BGA) e sulle caratteristiche visibili esternamente (EVC) del donatore di un campione probatorio. Attualmente, l'inferenza basata sul polimorfismo a singolo nucleotide (SNP) di BGA ed EVC viene eseguita più comunemente utilizzando SNaPshot ® , un test di estensione a base singola (SBE). Tuttavia, una singola PCR multiplex SNaPshot è limitata a 30-40 SNP. Il sequenziamento di nuova generazione (NGS) offre la possibilità di genotipizzare da centinaia a migliaia di SNP da più campioni in una singola corsa sperimentale. I multiplex PCR di cinque saggi SNaPshot (SNPperID 52plex, SNPperID 34plex, Eurasiaplex, IrisPlex e un test BGA non pubblicato) sono stati applicati a tre diverse quantità di DNA template (0,1, 0,2 e 0,3 ng) in tre campioni (9947A e 007 DNA di controllo e un donatore maschio). Gli ampliconi PCR raggruppati contenenti 136 SNP unici sono stati sequenziati utilizzando il sistema Ion Torrent™ PGM di Life Technologies. Circa 72 Mb di sequenza sono stati generati da due chip Ion 314™ v1 da 10 Mb. Genotipi accurati sono stati facilmente ottenuti da tutte e tre le quantità di stampo. Su un totale di 408 genotipi, 395 (97%) erano pienamente concordanti con SNaPshot per tutte e tre le quantità di template. Di quei genotipi discordanti con SNaPshot, sei sequenze Ion Torrent (1,5%) erano completamente concordanti con il sequenziamento di Sanger attraverso le tre quantità di template. Sette SNP (1,7%) erano discordanti tra gli importi del modello o discordanti con il sequenziamento di Sanger. La copertura della sequenza osservata nel controllo negativo e la variazione della copertura allelica per i genotipi eterozigoti evidenzia la necessità di stabilire una soglia per i livelli di fondo dell'output della sequenza e dell'equilibrio eterozigote. Questo studio preliminare del sistema Ion Torrent PGM ha dimostrato un notevole potenziale per l'uso nelle analisi forensi del DNA come piattaforma NGS a bassa e media velocità utilizzando saggi SNaPshot consolidati.


DNA polimerasi ad alta fedeltà Q5®

Q5 ® High-Fidelity DNA Polymerase (NEB #M0491) stabilisce un nuovo standard sia per la fedeltà che per le prestazioni robuste. Con la massima fedeltà di amplificazione disponibile (>280 volte superiore a Taq), Q5 DNA polimerasi si traduce in tassi di errore estremamente bassi. La DNA polimerasi Q5 è composta da una nuova polimerasi che viene fusa al dominio di legame del DNA Sso7d che migliora la processività, migliorando la velocità, la fedeltà e l'affidabilità delle prestazioni. Le master mix Q5 contengono dNTP, Mg++ e un tampone proprietario ad ampio uso che richiede solo l'aggiunta di primer e DNA template per un'amplificazione robusta, indipendentemente dal contenuto di GC.

NOVITÀ: DNA polimerasi ad alta fedeltà Q5U Hot Start (NEB #M0515). Q5U è una versione modificata della DNA polimerasi ad alta fedeltà Q5 contenente una mutazione nella tasca legante l'uracile che consente la capacità di leggere e amplificare modelli contenenti basi di uracile e inosina. Ciò è utile per amplificare il DNA convertito con bisolfito, deaminato enzimaticamente o danneggiato, prevenendo la contaminazione da riporto nella PCR (se utilizzata con dUTP e UDG) e nei metodi di clonazione USER. Ulteriori informazioni su questo prodotto.

Confronto tra polimerasi ad alta fedeltà

1 Continuiamo a studiare test migliorati per caratterizzare il tasso di errore molto basso di Q5 per garantire che presentiamo i dati di fedeltà più accurati possibili (Potapov, V. e Ong, J.L. (2017) PLoS ONE. 12 (1): e0169774).
2 Screening delle mutazioni basato su PCR in lacI (Agilent) o rpsL (Life).

Vantaggi

  • Amplificazione ad alta fedeltà (>280X superiore a Taq)
  • Tassi di errore estremamente bassi
  • Prestazioni superiori per un'ampia gamma di ampliconi (da AT elevato a GC elevato)
  • Disponibili formati hot start e master mix

Il sistema tampone Q5 è progettato per fornire prestazioni superiori con un'ottimizzazione minima su un'ampia gamma di ampliconi, indipendentemente dal contenuto del GC. Per ampliconi di routine o complessi fino a

Contenuto di GC al 65%, Q5 Reaction Buffer (NEB #B9027) fornisce un'amplificazione affidabile e robusta. Per gli ampliconi con un alto contenuto di GC (>65% GC), l'aggiunta di Q5 High GC Enhancer garantisce prestazioni massime continue. Le DNA polimerasi Q5 e Q5 Hot Start sono disponibili come enzimi autonomi o in un formato master mix per una maggiore comodità. Le formulazioni della miscela master includono dNTP, Mg ++ e tutti i componenti tampone necessari.

Amplificazione robusta con DNA polimerasi ad alta fedeltà Q5 (A) e Q5 Hot Start (B)

Amplificazione di una varietà di ampliconi genomici umani da basso ad alto contenuto di GC utilizzando la DNA polimerasi ad alta fedeltà Q5 o Q5 Hot Start. Le reazioni utilizzando Q5 Hot Start sono state impostate a temperatura ambiente. Tutte le reazioni sono state condotte utilizzando 30 cicli di amplificazione e visualizzate mediante analisi microfluidica LabChip®.

A differenza delle polimerasi hot start chimicamente modificate o basate su anticorpi, Q5 Hot Start di NEB (NEB # M0493) utilizza un aptamero sintetico unico. Questa molecola si lega alla polimerasi attraverso interazioni non covalenti, bloccando l'attività durante l'impostazione della reazione. La polimerasi viene attivata durante le normali condizioni di ciclo, consentendo l'instaurazione di reazioni a temperatura ambiente. Q5 Hot Start non richiede un passaggio separato di attivazione ad alta temperatura, riducendo i tempi di reazione e aumentando la facilità d'uso. Q5 Hot Start Polymerase è la scelta ideale per l'amplificazione ad alta specificità e fornisce un'amplificazione robusta di un'ampia varietà di ampliconi, indipendentemente dal contenuto di GC.

Prestazioni di amplificazione su un'ampia gamma di target genomici

La PCR è stata eseguita con una varietà di ampliconi, con contenuto di GC compreso tra AT elevato e GC elevato, con Q5 e diverse altre polimerasi disponibili in commercio. Tutte le polimerasi sono state ciclate secondo le raccomandazioni del produttore, incluso l'uso di GC Buffer e enhancer quando raccomandato. La resa e la purezza dei prodotti di reazione sono state quantificate e rappresentate, come mostrato nella legenda della figura, per colore e dimensione del punto. Un grande punto verde scuro rappresenta la performance di maggior successo. Q5 offre prestazioni superiori su tutta la gamma di contenuti GC.

I formati master mix e stand-alone offrono praticità e flessibilità

Q5 ® è un marchio registrato di New England Biolabs, Inc.
LabChip ® è un marchio registrato di Caliper Life Sciences, parte di Perkin Elmer, Inc.

Scegli il tipo:

  • FAQ
  • Protocolli
  • Note applicative
  • Strumenti e risorse
  • Pubblicazioni
  • Strumento di selezione PCR
  • Confronto tra polimerasi ad alta fedeltà
  • La DNA polimerasi Q5 offre un'amplificazione superiore per un'ampia gamma di modelli
  • Cinque caratteristiche di qualità di Q5
  • Tabella di selezione della DNA polimerasi
  • Informazione legale

Articoli in evidenza

Leggi la relazione tra la struttura e la funzione della polimerasi durante la copia del DNA.

Brochure

Strumenti di selezione

Guide alla risoluzione dei problemi

Linee guida per l'uso

  1. Fedeltà &ndash l'amplificazione ad alta fedeltà disponibile (>100X superiore a Taq)
  2. Robustezza &ndash elevata specificità e rendimento con un'ottimizzazione minima
  3. Copertura &ndash prestazioni superiori per un'ampia gamma di ampliconi (da AT elevato a GC elevato)
  4. Velocità &ndash brevi tempi di estensione
  5. Lunghezza dell'amplificatore &ndash robuste amplificazioni fino a 20 kb per modelli semplici e 10 kb per complessi

NEB offre linee guida per la scelta della DNA polimerasi corretta per la propria applicazione fornendo un elenco di proprietà specifiche. Diversi fattori determinano quale polimerasi deve essere utilizzata in una data applicazione, tra cui:

Specificità del modello/prodotto: È coinvolto l'RNA o il DNA? Il capolinea 3' si trova in uno spazio vuoto, in un nick o alla fine del modello?

Rimozione di nucleotidi esistenti: I nucleotidi verranno rimossi dalla catena polinucleotidica esistente come parte del protocollo? In tal caso, verranno rimossi dall'estremità 5´ o 3´?

Stabilità termica: La polimerasi deve sopravvivere all'incubazione ad alta temperatura o è desiderabile l'inattivazione al calore?

Fedeltà: La successiva analisi o espressione della sequenza dipenderà dalla fedeltà dei prodotti sintetizzati?

Questo prodotto è coperto da uno o più brevetti, marchi e/o copyright di proprietà o controllati da New England Biolabs, Inc (NEB).

Sebbene NEB sviluppi e convalidi i suoi prodotti per varie applicazioni, l'uso di questo prodotto potrebbe richiedere all'acquirente di ottenere ulteriori diritti di proprietà intellettuale di terze parti per determinate applicazioni.

Per ulteriori informazioni sui diritti commerciali, contattare il team Global Business Development di NEB all'indirizzo [email protected]

Questo prodotto è destinato esclusivamente a scopi di ricerca. Questo prodotto non è destinato all'uso per scopi terapeutici o diagnostici nell'uomo o negli animali.


Cosa è pianificato?

- aggiungerà il supporto per i cookie per ricordare i parametri di input assegnati individualmente da una sessione all'altra. Se utilizzi un set di parametri standard, non dovrai più reinserirli ogni volta che visiti il ​​server muPlex. L'utilizzo dei cookie sarà del tutto facoltativo. Se i cookie sono disattivati ​​nel tuo browser, l'interfaccia tornerà silenziosamente ai suoi parametri predefiniti.

- introdurrà un forum muPlex (wiki?) per fornire supporto al nostro elenco di utenti in espansione!

- Hai idee per migliorare muPlex? I nostri continui sforzi di sviluppo sono principalmente in risposta ai suggerimenti forniti dai nostri utenti. (Vedere Domande e feedback sotto.)


Polemiche sul vaccino HPV

Durante un dibattito tra i candidati presidenziali repubblicani nel 2011, Michele Bachmann, uno dei candidati, ha insinuato che il vaccino per l'HPV non è sicuro per i bambini e può causare ritardo mentale. Scienziati e altri operatori sanitari hanno immediatamente prodotto prove per confutare questa affermazione. UN USA Today articolo, “No Evidence HPV Vaccines Are Dangerous” (19 settembre 2011), ha descritto due studi dei Centers for Disease Control and Prevention (CDC) che tracciano la sicurezza del vaccino. Ecco un estratto dell'articolo:

  • Innanzitutto, il CDC monitora le segnalazioni al Vaccine Adverse Event Reporting System, un database a cui chiunque può segnalare un sospetto effetto collaterale. I funzionari del CDC indagano quindi per vedere se i problemi segnalati potrebbero essere causati dai vaccini o sono semplicemente una coincidenza. In secondo luogo, il CDC ha seguito le ragazze che ricevono il vaccino nel tempo, confrontandole con un gruppo di controllo di ragazze non vaccinate. Di nuovo, il vaccino HPV è risultato sicuro.

Secondo un articolo di Elizabeth Rosenthal, "La spinta dei produttori di droga conduce all'aumento dei vaccini contro il cancro" (New York Times, 19 agosto 2008), la FDA e il CDC hanno affermato che "con milioni di vaccinazioni, solo per caso si verificheranno alcuni effetti avversi gravi e decessi nel periodo successivo alla vaccinazione, ma non hanno nulla a che fare con il vaccino". L'articolo affermava che la FDA e il CDC monitorano i dati per determinare se si verificano effetti più gravi di quanto ci si aspetterebbe dal solo caso.

Secondo un'altra fonte, i dati del CDC suggeriscono che gravi problemi di salute dopo la vaccinazione si verificano con un tasso di circa 3 su 100.000. Questa è una proporzione di 0,00003. Ma questi problemi di salute sono dovuti al vaccino? Il tasso di problemi di salute simili è diverso per coloro che non ricevono il vaccino? Supponiamo che non ci siano differenze nel tasso di gravi problemi di salute tra il gruppo di trattamento e quello di controllo. Cioè, supponiamo che la proporzione di gravi problemi di salute in entrambi i gruppi sia 0,00003.

Supponiamo che il CDC segua un campione casuale di 100.000 ragazze che hanno avuto il vaccino e un campione casuale di 200.000 ragazze che non hanno avuto il vaccino. Nel tempo, calcolano la proporzione in ciascun gruppo che ha gravi problemi di salute.

Domanda: Quanta differenza in queste proporzioni del campione è insolita se il vaccino non ha alcun effetto sull'insorgenza di gravi problemi di salute?

Per rispondere a questa domanda, dobbiamo vedere quanta variazione possiamo aspettarci nei campioni casuali se non c'è differenza nella frequenza con cui si verificano gravi problemi di salute, quindi usiamo la distribuzione campionaria delle differenze nelle proporzioni del campione.

  • Spread: i campioni grandi produrranno un errore standard molto piccolo. L'errore standard delle differenze nelle proporzioni campionarie è

Risposta: Possiamo visualizzare campioni casuali che variano di più di 2 errori standard dalla media come insoliti. Se non c'è differenza nella frequenza con cui si verificano gravi problemi di salute, la media è 0. Quindi le differenze nei tassi maggiori di 0 + 2(0,00002) = 0,00004 sono insolite. Ciò equivale a circa 4 casi in più di gravi problemi di salute su 100.000. Con campioni così grandi, vediamo che un piccolo numero di casi aggiuntivi di gravi problemi di salute nel gruppo vaccinato apparirà insolito. Ma 4 casi su 100.000 hanno un significato pratico visti i potenziali benefici del vaccino? Questa è una domanda importante da affrontare per il CDC.

Provalo

Secondo uno studio del 2008 pubblicato dall'AFL-CIO, il 78% dei lavoratori sindacali aveva un lavoro con copertura sanitaria del datore di lavoro rispetto al 51% dei lavoratori non sindacali. Nel 2009, l'Employee Benefit Research Institute ha citato dati provenienti da ampi campioni che suggerivano che l'80% dei lavoratori sindacali aveva una copertura sanitaria rispetto al 56% dei lavoratori non sindacali. Supponiamo che i dati del 2009 provengano da campioni casuali di 3.000 lavoratori sindacali e 5.000 lavoratori non sindacali.

Provalo

Quello che segue è un estratto da un comunicato stampa sul sito web dell'AFL-CIO pubblicato nell'ottobre del 2003.

  • Wal-Mart esemplifica la tendenza dannosa tra i grandi datori di lavoro americani a sottrarsi alle responsabilità dell'assicurazione sanitaria a spese dei loro lavoratori e della comunità…. Con una copertura ridotta e un aumento delle tariffe dei lavoratori, Wal-Mart – il più grande datore di lavoro privato negli Stati Uniti – stabilisce uno standard preoccupante. Meno della metà dei lavoratori Wal-Mart è assicurata secondo il piano aziendale, solo il 46%. Secondo un nuovo studio del Commonwealth Fund pubblicato oggi, questo tasso è drammaticamente inferiore al 66 percento dei lavoratori delle grandi aziende private che sono assicurati nell'ambito dei piani delle loro aziende, che documenta la crescente tendenza tra i grandi datori di lavoro a rinunciare all'assicurazione sanitaria per i propri dipendenti.

Supponiamo di voler vedere se questa differenza riflette la copertura assicurativa per i lavoratori della nostra comunità. Selezioniamo un campione casuale di 50 dipendenti Wal-Mart e 50 dipendenti di altre grandi aziende private nella nostra comunità. Supponiamo che 20 dei dipendenti Wal-Mart e 35 degli altri dipendenti abbiano un'assicurazione tramite il loro datore di lavoro.


Domande frequenti su AmpliSeq for Illumina Custom e Community Panels

No, al momento non è prevista una nuova versione. I pannelli standard e i pannelli comunitari si basano su hg19. La conversione di pannelli pre-progettati può essere presa in considerazione in futuro in base alla domanda del mercato.

Studio di progettazione

Quali sono le dimensioni dell'amplicone target?

L'amplicone può avere un intervallo in cui si seleziona la dimensione massima dell'amplicone.

Le dimensioni degli ampliconi sono equivalenti alle dimensioni degli inserti?

Poiché digeriamo i primer durante la fase di digestione parziale degli ampliconi, le dimensioni degli inserti risultanti saranno inferiori alle dimensioni dell'amplicone. A seconda della lunghezza di lettura scelta, si consiglia di tagliare l'adattatore.

Perché alcuni obiettivi sono difficili da progettare in DesignStudio?
  • omologhi: Avere omologhi nello stesso design può portare a una bassa designabilità. Dividi gli omologhi in pool separati.
  • Contenuto GC: Le regioni con un contenuto di GC superiore all'80% può essere difficile da progettare, in particolare quando queste regioni hanno una lunghezza superiore a 500 bp.
  • Sequenze omopolimeriche ed elementi ripetitivi: DesignStudio evita queste regioni per assicurarsi che le sonde abbiano una migliore specificità nel genoma.
  • Specificità scarsa: DesignStudio valuterà la specificità delle sonde ed escluderà quelle che non forniranno una copertura soddisfacente sul bersaglio.
In che modo DesignStudio seleziona i primer?

Le sonde ottimali vengono scelte utilizzando un algoritmo che considera la temperatura di fusione (Tm), % GC, lunghezza, struttura secondaria, unicità nel genoma e presenza di SNP sottostanti (basati su dbSNP). Per ulteriori informazioni, vedere la guida in linea di DesignStudio.

Come posso migliorare la designabilità e la copertura nel mio progetto DesignStudio?
  • Aumentare le dimensioni dell'obiettivo contro cui progettare può salvare regioni precedentemente "non progettabili". La maggiore dimensione di un target offre a DesignStudio un po' più di flessibilità per adattare un amplicone a punteggio più alto sulle basi target desiderate.
  • Modificare il contesto del pannello: ad esempio, inserire una sequenza target altamente omologa o ricca di GC nello stesso design multiplex può essere problematico per la progettazione di sonde per amplificare ogni target in modo discreto. Lo spostamento di aree problematiche in un progetto separato può spesso migliorare la progettabilità.
  • Modificare i livelli di rigore.
Posso creare un design a doppia piscina?

No. Questa è una PCR multiplex che non sarà in grado di distinguere tra il filamento superiore e quello inferiore.

Posso modificare il contenuto del mio design dopo averlo inviato?

No. Tuttavia, puoi utilizzare il pulsante "Modifica design" per copiare il contenuto in un nuovo pannello e quindi modificarlo.

Posso modificare il mio design dopo aver effettuato un ordine?

No. Dopo aver effettuato un ordine, non puoi modificare il design. I file necessari per l'analisi da BaseSpace Sequence Hub e Local Run Manager devono rimanere sincronizzati con il materiale ordinato.

Qual è l'attuale tempo di consegna per un progetto presentato rispetto alla dimensione o al numero di obiettivi target?

Un design più piccolo di 250 kb ha un tempo di consegna previsto di 48 ore o meno. I progetti più grandi di 250 kb o con molti target possono richiedere più di 48 ore per essere restituiti.

I progetti su richiesta hanno tempi di consegna più brevi rispetto ad altri invii. I progetti On-Demand di 250 kb o meno devono essere restituiti in meno di 2 ore.

Cosa determina i criteri di progettazione dell'amplicone?

Attualmente, DesignStudio consente agli utenti di scegliere una dimensione dell'amplicone di 140, 175, 275 o 375 (consigliata per MiSeq) per ogni progetto. La dimensione dell'amplicone include le sequenze di primer e le regioni di inserimento. Si consiglia di utilizzare 175 bp per DNA FFPE, 140 bp per cfDNA e 275 bp per DNA normale.

È possibile utilizzare un design AmpliSeq for Illumina per lo screening di molti SNP (fino a 1000 o più) per molti individui (fino a 1000 o più)?

Sì, DesignStudio consente la genotipizzazione SNP mediante sequenziamento.

Qual è il progetto più grande che posso inviare alla pipeline AmpliSeq for Illumina?

Puoi inviare progetti fino a 500 kb direttamente alla pipeline. Il gasdotto è capace di elaborare progetti fino a 5 Mb, ma tali progetti sono costosi e richiedono una grande quantità di risorse computazionali.

Ti consigliamo di inviare solo progetti fino a 2 Mb. Per i design tra 2 Mb e 5 Mb, ti consigliamo di contattare il tuo specialista di vendita.

Quali pannelli posso usare per aggiungere ampliconi a un nuovo design?

È possibile copiare ampliconi da pannelli AmpliSeq for Illumina personalizzati, di comunità e fissi utilizzando la stessa specie del progetto. Per informazioni sulla community disponibile e sui pannelli fissi, contattare l'Assistenza tecnica Illumina.

DesignStudio - Primer Bioinformatica

Qual è il livello di sovrapposizione tra i primer?

I primer nella stessa piscina/tubo non si sovrappongono.

Con i progetti AmpliSeq per Illumina in DesignStudio, i set di primer vengono progettati automaticamente (con un programma per computer), senza interrogazione da parte di un ricercatore?

Il processo è una pipeline automatizzata, ottimizzata per fornire la massima copertura con set di primer affidabili.

DesignStudio - Ordini Oligo

Posso aggiungere qualche altro gene a una serie di primer ordinati in precedenza?

No. Devi modificare il design, aggiungere i nuovi geni e inviare un nuovo ordine.

Se ho primer regolari per una regione e so che funzionano, posso aggiungerli al mio progetto AmpliSeq for Illumina?
Posso aggiungere primer manualmente, dopo la progettazione, per coprire completamente una regione?

No. Usiamo primer appositamente modificati, quindi i primer standard non consentiranno la costruzione di librerie.

Esiste un ordine minimo per AmpliSeq for Illumina Gene e Hotspot design?

I pannelli personalizzati AmpliSeq per Illumina vanno da 12 ampliconi a 3.072 ampliconi per pool. Le regioni target possono essere piccole fino a 1 bp, ma poiché i progetti devono includere 12 ampliconi, sono necessari 12 set di regioni da 1 bp.

Tutti gli ordini hanno un prezzo minimo equivalente al costo di un ordine contenente 48 ampliconi.

In quale formato di contenitore devo aspettarmi di ricevere i miei primer personalizzati?

Ogni pool di primer personalizzato viene fornito come tubo pre-raggruppato.

Come posso conoscere lo stato dell'invio di un progetto ad AmpliSeq per il pannello personalizzato Illumina?

E-mail [email protected] Utilizzare il numero ID del progetto AmpliSeq for Illumina o il numero ID della soluzione quando si fa riferimento all'ordine.

DesignStudio - Risoluzione dei problemi e convalida

Supponiamo che mi rivolga a una regione e DesignStudio suggerisce un progetto costituito da due pool di primer. Per ogni campione, devo preparare una libreria per ogni amplificazione (ogni pool)? Oppure devo unire le due amplificazioni (i prodotti dei due pool amplificati) e poi preparare la libreria?

Se il progetto risulta in più pool, ogni pool viene elaborato in modo indipendente tramite "Amplify DNA/cDNA Targets" come indicato nella Guida di riferimento del pannello personalizzato e comunitario di AmpliSeq for Illumina. I pool vengono quindi combinati prima della fase "Partially Digest Amplicons". Continuano come un campione attraverso la legatura dell'indice e l'amplificazione finale della libreria.

Quante coppie di basi separano i primer dalla regione bersaglio?

Per assicurarci che un intero esone sia coperto, per impostazione predefinita, aggiungiamo 25 bp di riempimento a monte ea valle della regione target selezionata. Questa imbottitura lascia spazio per posizionare i primer. L'imbottitura garantisce un sequenziamento di alta qualità alle estremità degli esoni e consente un certo sequenziamento nelle regioni di giunzione della giunzione. Le regioni del primer non sono considerate coperte. Pertanto, se la copertura ottenuta dal progetto iniziale è inferiore al 100%, possiamo provare ancora una volta ad estendere ulteriormente il primer nell'introne per catturare l'intero esone.

Ingresso

Quale quantità di DNA è richiesta?

Il saggio utilizza tra 1 e 100 ng di DNA per pool di primer, con la maggior parte dei progetti che utilizzano 10 ng per pool.

Quale qualità di DNA è richiesta e come dovrebbe essere valutata la qualità del DNA?

Abbiamo riscontrato successo con input di bassa qualità utilizzando le modifiche al protocollo indicate nelle guide per l'utente. I metodi di estrazione del DNA disponibili in commercio o convalidati in laboratorio in genere producono DNA compatibile con questo dosaggio. La purezza del DNA dovrebbe avere un rapporto A260/A280 di 1,8–2,0. PicoGreen è consigliato per una quantificazione accurata.

I campioni FFPE sono supportati?

Utilizzare solo DNA derivato da FFPE quando si utilizzano brevi lunghezze di ampliconi di 140 o 175 bp. Gli ampliconi più corti forniscono un'amplificazione migliore rispetto a quelli più lunghi quando l'input del campione è un DNA frammentato derivato da FFPE.

Quanto DNA può essere preso di mira con questo kit?

Esiste un limite di 12-6.144 coppie di primer per pool. Se si genera una regione di destinazione maggiore di 5 Mb, si consiglia di selezionare un'opzione di arricchimento.

Protocollo

Questo test utilizza gli adattatori Nextera o TruSeq standard?

Gli adattatori utilizzati in questo dosaggio sono ottimizzati per il flusso di lavoro AmpliSeq. Gli adattatori Nextera o TruSeq non sono compatibili con questo test.

Cosa è necessario per acquistare da Illumina?
Posso eseguire due o tre diverse amplificazioni e poi unirle prima di passare alla preparazione della libreria?

È possibile eseguire 3 diversi modelli di AmpliSeq for Illumina ciascuno con codici a barre sulla stessa corsa di sequenziamento. Tuttavia, la dimensione dell'amplicone target e la copertura richiesta devono essere raggiunte in un'unica corsa.

Sequenziamento

Quale lunghezza di lettura è consigliata per il sequenziamento?

Si consiglia una lettura paired-end di 2×150 bp per dimensioni di ampliconi di 140-275 bp. Si consiglia una corsa paired-end fino a 2x300 bp su MiSeq per dimensioni di ampliconi da 375 bp.

Quanti campioni possono essere sequenziati alla volta?

Questo kit dispone di codici a barre dei campioni integrati che consentono di raggruppare fino a 96 campioni per corsa di sequenziamento. Tuttavia, il numero effettivo di campioni che possono essere raggruppati insieme per corsa di sequenziamento dipende dal numero di ampliconi e dalla profondità di copertura del sequenziamento desiderata. Un calcolatore online è fornito in DesignStudio per aiutare con questi calcoli.

Analisi

Quali strumenti sono offerti per l'analisi dei dati?

Local Run Manager e BaseSpace Sequence Hub dispongono di app per l'analisi. L'app DNA Amplicon Analysis e l'app RNA Amplicon Analysis sono disponibili su BaseSpace Sequence Hub. È possibile eseguire ulteriori analisi su qualsiasi chiamata di variante utilizzando BaseSpace Variant Interpreter. Local Run Manager ha un modulo di analisi dell'amplicone del DNA e un modulo di analisi dell'amplificatore dell'RNA simili che utilizzano lo stesso flusso di lavoro e algoritmo delle app BaseSpace Sequence Hub.

Il flusso di lavoro dell'analisi del DNA Amplicon può essere utilizzato per eseguire l'allineamento e l'identificazione delle varianti e il flusso di lavoro dell'analisi dell'RNA Amplicon per l'identificazione della fusione. Inoltre, il chiamante OncoCNV, un BaseSpace Lab Apps è disponibile per l'analisi CNV.

Ci sono dati di esempio che posso visualizzare?

Sì, ci sono set di dati di esempio in BaseSpace Public Data.

Quali effettive prestazioni del test posso aspettarmi dal mio progetto?

DesignStudio restituisce progetti di ampliconi ad alta affidabilità che hanno fornito prestazioni di multiplexing degli amplificatori senza precedenti. Since each design is unique and sample input can vary, performance of the design will need to be tested empirically.

Are there non-encrypted manifest files available for my RNA panels (custom or fixed) containing fusions?

No. Manifest files for any RNA panel containing fusions are unavailable in a non-encrypted format. Only the encrypted manifest file is available.

Where can I find the breakpoint details for fusion panels (custom or fixed) included in the design?

Information about exact breakpoints contained in all RNA fusion panel designs is not provided. The result files produced by Illumina software analysis tools provide details of any RNA fusion events identified by the software. For information on which gene pairs are evaluated for your panel, see the panel's data sheet.

Where can I find my alignment files (eg, BAM files) from my analysis of RNA panels containing fusions?

Illumina software packages, including BaseSpace Sequence Hub Apps, do not provide alignment files as output from the analysis. At this time, only the final reporting of the results from the analysis are provided. For more details, consult the software's documentation.

Is there any information about potential false negatives or uncalled fusions from analysis of RNA panels containing fusions?

No. The software only reports detected fusion events. For information on which gene pairs are evaluated for your panel, see the panel's data sheet.

AmpliSeq for Illumina On-Demand

What is the minimum number of genes I can order in an On-Demand panel?

We’ve set an ordering minimum of 1 gene or 24 amplicons per panel. Designs must also have at least 2 pools and 12 amplicons per pool.

What is the maximum number of genes I can order in an On-Demand panel?

We have set an ordering maximum of 500 genes or 15,000 amplicons per panel due to manufacturing restrictions. We are always making improvements, so this limit is likely to increase. You may be able to order larger designs in the future.

What annotation source and version is used to recognize gene symbols when creating an On-Demand Panel?

Illumina uses RefGene v74 as the source of annotations.

Are untranslated regions (UTRs) included in an On-Demand gene’s design?

No, only the coding DNA sequence (CDS) region of a gene is included as part of an On-Demand gene design.

What is “Gene Amplicon Uniformity”?

Gene amplicon uniformity is the percentage of amplicons for a gene with greater than 0.2 times the mean coverage of all amplicons targeting that gene. It represents the observed wet-lab uniformity calculated from NextSeq data with the Illumina DNA Amplicon workflow.

Do On-Demand panels support UTR-only genes? What about pseudogenes?

No. On-Demand panels only support genes containing CDS regions. Pseudogenes are not supported.

What is the padding used for On-Demand gene designs?

The padding for every On-Demand gene design is 5 bp on the 5′ and 3′ ends of the exon.

Have all possible gene combinations been tested for primer-primer interactions?

No. The number of possible combinations is astronomical. It is not feasible to test for all possible combinations in the lab. However, through computer-based searches, we have reduced the occurrence of primer-primer interactions as much as possible. In addition, when synthesizing many genes simultaneously in large batches, we have observed less than 1% amplicon drop-out due to suspected primer-primer interactions.

Why are the number of primer pairs per pool indicated on the tube and box labels different than the number of amplicons per pool indicated in DesignStudio?

Il numero di amplicons per pool in DesignStudio reflects the number of unique amplicons in each pool. Il numero di primer pairs per pool on the tube and box labels reflects the total number of oligos per pool. Either value can be used when preparing libraries according to the AmpliSeq for Illumina On-Demand, Custom and Community Panels Reference Guide (Table 4. X cycles and X minutes). If the values fall into different cycle categories, the higher PCR cycle number is recommended.

AmpliSeq for Illumina On-Demand – IGV Viewer

What is the “observed coverage” track in the IGV viewer?

The “observed coverage” track indicates the number of observed reads for each amplicon of each targeted gene during validation experiments on a NextSeq. Use this track as general guidance for the likely performance when running an experiment. While values can vary among assays, the general coverage trend should remain consistent.

What are “Gaps”?

Gaps occur where there are no amplicons to provide coverage for the intended target. We have made every effort to minimize the occurrence of these regions in our On-Demand designs.

What is the scale on the Y-axis?

The Y-axis represents the observed coverage normalized by the mean amplicon coverage for the gene.

Can I use coordinates to navigate the IGV viewer?

No. The IGV viewer can only focus on your gene of interest. In the Grid View, select a gene, and the IGV viewer updates automatically to center on that gene.

I notice that the “observed coverage” track for an amplicon occasionally does not appear to contain information. Perché?

All amplicons in the design contain reads that are visualized in the “observed coverage” track. If the number of reads covering an amplicon is relatively small in comparison to neighboring amplicons, the “observed coverage” track appears empty. However, if you change the scale to a lower value, you will then be able to visualize the lower number of reads. If the observed coverage track is not present, the designer notifies you why that track is not available.

Contattaci
Technical Support
Share With Tech Support

Get instructions for sharing your desktop while working with Technical Support.

Other Support
Contattaci
Technical Support
[email protected]
Other Support

Innovative technologies

At Illumina, our goal is to apply innovative technologies to the analysis of genetic variation and function, making studies possible that were not even imaginable just a few years ago. It is mission critical for us to deliver innovative, flexible, and scalable solutions to meet the needs of our customers. As a global company that places high value on collaborative interactions, rapid delivery of solutions, and providing the highest level of quality, we strive to meet this challenge. Illumina innovative sequencing and array technologies are fueling groundbreaking advancements in life science research, translational and consumer genomics, and molecular diagnostics.

Solo per uso di ricerca. Non per l'uso in procedure diagnostiche (ad eccezione di quanto specificamente indicato).


COVER: a priori estimation of coverage for metagenomic sequencing

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Systems Biology Programme, Centro Nacional de Biotecnología (CNB-CSIC). C/Darwin 3, 28049 Madrid, Spain.

Riepilogo

In any metagenomic project, the coverage obtained for each particular species depends on its abundance. This makes it difficult to determine a priori the amount of DNA sequencing necessary to obtain a high coverage for the dominant genomes in an environment. To aid the design of metagenomic sequencing projects, we have developed COVER, a web-based tool that allows the estimation of the coverage achieved for each species in an environmental sample. COVER uses a set of 16S rRNA sequences to produce an estimate of the number of operational taxonomic units (OTUs) in the sample, provides a taxonomic assignment for them, estimates their genome sizes and, most critically, corrects for the number of unobserved OTUs. COVER then calculates the amount of sequencing needed to achieve a given goal. Our tests and simulations indicate that the results obtained through COVER are in very good agreement with the experimental results.

Figura S1. The accuracy of the estimation of the fraction of 16S rRNA sequences belonging to unobserved OTUs (Good&aposs sample coverage). The results were obtained using a simulated data set composed of 16S rRNA sequences corresponding to 200 genomes, with abundances following a log-normal distribution (upper panel) or a broken-stick distribution (lower panel). Both distributions are used in ecology: the first is widely found in many natural communities, whereas the second is predicted for communities where the resources are partitioned into niches at random. Although microbial communities usually do not follow the broken-stick distribution, we wanted to test the performance of our calculation under this model of extremely high evenness. The insets show a rank-abundance graph showing the shapes of the respective distributions, with species ranked by abundance on the X-axis. The expected number of sequences is calculated using Good&aposs estimator, as described in the main text, whereas the real numbers are obtained by the random sampling of the number of sequences indicated by the X-axis.

Figura S2. Accuracy of the estimation of unknown genome sizes. Upper: The difference in the genome size (expressed as |S1 − S2/max(S1, S2)|, with S1 and S2 representing the real sizes of the genomes) for pairs of genomes of known sizes, in relation to their taxonomic proximity. The relationship between the genome size and taxonomic relatedness is apparent. For instance, genomes related at the species level (i.e. different strains from the same species) usually have less than a 10% difference in genome size. If the genomes belong to the same genus, the difference can extend to 25%, although in most cases, it remains at 10% or less. Lower: Use of the genome sizes of sequenced species to infer the sizes for species currently being sequenced (species ‘in progress’ in the NCBI database, http://www.ncbi.nlm.nih.gov/genomes/lproks.cgi, whose size has been estimated, usually via PFGE). The plot shows the probability of inferring the size correctly using the sizes of other species at different taxonomic ranks. For instance, the case marked by a dashed line in the plot corresponds to the estimation of the size of some species using the known sizes of other species from the same genus. In that case, there is an approximate 75% probability that we can infer its genome size with less than 10% error.

Figura S3. Accuracy of the estimation of the 16S rRNA copy number. Differences in copy number (expressed as |C1 − C2/max(C1, C2)|, with C1 and C2 representing the numbers of 16S copies in the genomes) for pairs of genomes of known copy number, in relation to their taxonomic proximity.

Figura S4. Variation of the estimated coverage in relation to the number of 16S rRNA sequences provided. A community of 100 species was simulated, and the estimated coverage for the first 10 members was calculated by COVER using different initial numbers of 16S sequences, supposing a sequencing effort of 500 000 reads of 400 base pairs each. It can be seen that the estimates of coverage oscillate greatly when few sequences are provided, indicating that the community composition is still not well determined. When a substantial amount of 16S sequences is provided (between 2000 and 3000, in this case), the estimated coverage values stabilize and are very similar to the real coverage values (last point in the plot).

Fig. S5. Results of the estimation of coverage for a controlled data set composed of 100 genomes, with abundances following a log-normal distribution. The results are obtained by simulating the sequencing of 500 000 reads of 400 bp each. The plot shows the real coverage for each species (red line) and the obtained coverage predicted by COVER (green points). Species (genomes) are sorted according their abundances. Estimated coverage values match the real values very well. Some instances have no coverage estimated. These species have been merged with closely related ones because the 16S identity for the related species is 98% or more. Per esempio, Burkholderia cenocepacia is given a coverage of zero because it was merged with Burkholderia pseudomallei, whose coverage is, thus, overestimated. Both species share 98% identity in their 16S rRNA. There was a similar occurrence for two more cases in this experiment: Bacillus anthracis was merged with Bacillus cereus, e Escherichia fergusonii was merged with Escherichia coli.

Table S1. Upper: Number of taxa for each rank, as listed in NCBI&aposs taxonomy database (http://www.ncbi.nlm.nih.gov/Taxonomy) and the number of taxa containing at least one member with known size (from either complete genomes, genomes in progress or genomes with PFGE size estimates, http://www.genomesize.com/prokaryotes). Lower: Presence of families without any members of known genome size in the environmental samples (http://metagenomics.uv.es/envDB). In a set of 3035 samples, 810 contain a member from one of these families.

Table S2. Results obtained for the estimation of the number of reads needed for obtaining coverage 5× for the most represented genome in a controlled data set composed of 300 genomes, with abundances following a log-normal distribution. For studying the influence of inaccurate estimations of genomic sizes, we allowed these sizes to vary by some percentage of their original values. We draw a random value between 0 and a given percentage of the estimated genomic size, and added or subtracted that value to the estimation. The results obtained allowing 20% and 50% of variation are shown. The values change around 10% when allowing 20% of variation in the estimated sizes, and barely 25% when allowing 50% of variation.

Tabella S3. Comparison of the real and expected results for two metagenomic sequencing projects. The metagenomes were kindly provided by Dr Alejandro Mira (CSISP, Valencia, Spain), and they consist of two coupled sets of 16S and metagenomic sequences from oral samples. The first was obtained by sequencing amplicons from clone libraries. The contig length distributions for the real and expected instances were calculated as described in the text.

Filename Descrizione
EMI4_338_sm_FigS1.jpg165 KB Elemento informativo di supporto
EMI4_338_sm_FigS2.jpg207.5 KB Elemento informativo di supporto
EMI4_338_sm_FigS3.jpg61.4 KB Elemento informativo di supporto
EMI4_338_sm_FigS4.jpg93.6 KB Elemento informativo di supporto
EMI4_338_sm_FigS5.jpg46.1 KB Elemento informativo di supporto
EMI4_338_sm_TabS1.doc23 KB Elemento informativo di supporto
EMI4_338_sm_TabS2.doc27.5 KB Elemento informativo di supporto
EMI4_338_sm_TabS3.doc33.5 KB Elemento informativo di supporto

Nota: l'editore non è responsabile per il contenuto o la funzionalità delle informazioni di supporto fornite dagli autori. Qualsiasi domanda (diversa dal contenuto mancante) deve essere indirizzata all'autore corrispondente per l'articolo.


Guarda il video: DNA Sequencing: The Chain Termination Method Sanger Method (Agosto 2022).