Informazione

Primer WT di topo solido (C57BL/6)


Sto cercando di ottenere una buona coppia (o meglio ancora, una libreria di coppie) di primer che mi diano una banda nei topi WT (C57BL/6). Sapete dove potrei trovare una cosa del genere?

In alternativa, ho pensato di progettare da solo alcuni set di primer per regioni altamente conservate. Ma è un bel po' di indovinare (quali regioni, quali coppie da cosaeprimer3mi calcolerà ecc.).

Così:

  • Sapete dove si potrebbe trovare un database del genere?
  • In caso contrario, potresti aiutarmi a iniziare a crearlo da solo? Quali regioni specifiche secondo te sarebbero particolarmente adatte a questo scopo?

Ho optato per due primer GAPDH con un breve amplicone (~ 50 bp):

>gapdh_rv3  GAGACCTGAATGCTGCTTCC >gapdh_fw3  CTCCATTTCCCCTGTTCTCC

Forniscono controlli coerenti e buoni, come visto qui (bande inferiori):


Opzioni di accesso

Ottieni l'accesso completo al diario per 1 anno

Tutti i prezzi sono prezzi NETTI.
L'IVA verrà aggiunta in seguito al checkout.
Il calcolo delle tasse sarà finalizzato durante il checkout.

Ottieni l'accesso completo o limitato agli articoli su ReadCube.

Tutti i prezzi sono prezzi NETTI.


Akinsete JA, Ion G, Witte TR, Hardman WE (2012) Il consumo di una dieta ricca di acidi grassi omega-3 ha soppresso la tumorigenesi della prostata nei topi C3 (1) Tag. Carcinogenesi 33 (1): 140-148. https://doi.org/10.1093/carcin/bgr238

Akram M, Iqbal M, Daniyal M, Khan AU (2017) Consapevolezza e conoscenza attuale del cancro al seno. Biol Res 50(1):33. https://doi.org/10.1186/s40659-017-0140-9

Almind K, Kulkarni RN, Lannon SM, Kahn CR (2003) Identificazione di loci interattivi legati all'insulina e alla leptina nei topi con insulino-resistenza genetica. Diabete 52(6):1535–1543. https://doi.org/10.2337/diabetes.52.6.1535

Aprelikova O, Tomlinson CC, Hoenerhoff M, Hixon JA, Durum SK, Qiu TH, He S, Burkett S, Liu ZY, Swanson SM, Green JE (2016) Sviluppo e applicazione preclinica di un modello di trapianto immunocompetente di carcinoma mammario basale con polmone , metastasi epatiche e cerebrali. PLoS UNO 11(5):e0155262. https://doi.org/10.1371/journal.pone.0155262

Araujo MR, Campos LC, Damasceno KA, Gamba CO, Ferreira E, Cassali GD (2016) Espressione di HER-2, EGFR, Cox-2 e Ki67 nelle metastasi linfonodali dei carcinomi mammari canini: associazione con parametri clinico-patologici e sopravvivenza globale . Res Vet Sci 106:121–130. https://doi.org/10.1016/j.rvsc.2016.03.020

Armstrong NJ, Brodnicki TC, Speed ​​TP (2006) Mind the gap: analisi delle strategie di riproduzione assistita da marcatori per ceppi di topi consanguinei. Genoma di Mamm 17(4):273-287. https://doi.org/10.1007/s00335-005-0123-y

Asada N, Kunisaki Y, Pierce H, Wang Z, Fernandez NF, Birbrair A, Ma'ayan A, Frenette PS (2017) Contributi differenziali di citochine delle nicchie di cellule staminali ematopoietiche perivascolari. Nat Cell Biol. https://doi.org/10.1038/ncb3475

Baak JP, van Diest PJ, Voorhorst FJ, van der Wall E, Beex LV, Vermorken JB, Janssen EA (2005) Validazione multicentrica prospettica del valore prognostico indipendente dell'indice di attività mitotica in pazienti con carcinoma mammario linfonodi negativi di età inferiore a 55 anni anni. J Clin Oncol 23(25):5993–6001. https://doi.org/10.1200/JCO.2005.05.511

Balkwill FR, Capasso M, Hagemann T (2012) Il microambiente tumorale in sintesi. J Cell Sci 125 (Parte 23): 5591-5596. https://doi.org/10.1242/jcs.116392

Birbrair A, Wang ZM, Messi ML, Enikolopov GN, Delbono O (2011) Il transgene Nestina-GFP rivela cellule precursori neurali nel muscolo scheletrico adulto. PLoS UNO 6(2):e16816. https://doi.org/10.1371/journal.pone.0016816

Birbrair A, Zhang T, Wang ZM, Messi ML, Enikolopov GN, Mintz A, Delbono O (2013a) Ruolo dei periciti nella rigenerazione del muscolo scheletrico e nell'accumulo di grasso. Le cellule staminali si sviluppano 22(16):2298–2314. https://doi.org/10.1089/scd.2012.0647

Birbrair A, Zhang T, Wang ZM, Messi ML, Enikolopov GN, Mintz A, Delbono O (2013b) Le cellule progenitrici neurali del muscolo scheletrico mostrano proprietà di NG2-glia. Exp Cell Res 319 (1): 45–63

Birbrair A, Zhang T, Wang ZM, Messi ML, Enikolopov GN, Mintz A, Delbono O (2013c) I sottotipi di pericito muscolare scheletrico differiscono nel loro potenziale di differenziazione. Cellule staminali Res 10(1):67–84

Birbrair A, Zhang T, Wang ZM, Messi ML, Mintz A, Delbono O (2013d) I periciti di tipo 1 partecipano alla deposizione di tessuto fibroso nel muscolo scheletrico invecchiato. Am J Physiol Cell Physiol 305 (11): C1098-1113. https://doi.org/10.1152/ajpcell.00171.2013

Birbrair A, Zhang T, Files DC, Mannava S, Smith T, Wang ZM, Messi ML, Mintz A, Delbono O (2014a) I periciti di tipo 1 si accumulano dopo una lesione tissutale e producono collagene in modo organo-dipendente. Cellule staminali Res Ther 5(6):122. https://doi.org/10.1186/scrt512

Birbrair A, Zhang T, Wang ZM, Messi ML, Olson JD, Mintz A, Delbono O (2014b) I periciti di tipo 2 partecipano all'angiogenesi normale e tumorale. Am J Physiol Cell Physiol 307 (1): C25-38. https://doi.org/10.1152/ajpcell.00084.2014

Birbrair A, Sattiraju A, Zhu D, Zulato G, Batista I, Nguyen VT, Messi ML, Solingapuram Sai KK, Marini FC, Delbono O, Mintz A (2017) Nuove cellule staminali neurali derivate perifericamente come vettori terapeutici per il trattamento dei glioblastomi . Cellule staminali Transl Med 6(2):471–481. https://doi.org/10.5966/sctm.2016-0007

Boyd NF, Martin LJ, Bronskill M, Yaffe MJ, Duric N, Minkin S (2010) Composizione del tessuto mammario e suscettibilità al cancro al seno. J Natl Cancer Inst 102(16):1224-1237. https://doi.org/10.1093/jnci/djq239

Bray F, Ferlay J, Soerjomataram I, Siegel RL, Torre LA, Jemal A (2018) Statistiche globali sul cancro 2018: stime GLOBOCAN di incidenza e mortalità in tutto il mondo per 36 tumori in 185 paesi. CA Cancro J Clin 68(6):394-424. https://doi.org/10.3322/caac.21492

Bridges AE, Ramachandran S, Pathania R, Parwal U, Lester A, Rajpurohit P, Morera DS, Patel N, Singh N, Korkaya H, Manicassamy S, Prasad PD, Lokeshwar VB, Lokeshwar BL, Ganapathy V, Thangaraju M (2020) Il deficit di RAD51AP1 riduce la crescita del tumore mirando all'auto-rinnovamento delle cellule staminali. Cancer Res 80(18):3855–3866. https://doi.org/10.1158/0008-5472.CAN-19-3713

Brock A, Krause S, Li H, Kowalski M, Goldberg MS, Collins JJ, Ingber DE (2014) Il silenziamento di HoxA1 ​​mediante iniezione intraduttale di nanoparticelle lipidoidi siRNA previene la progressione del tumore mammario nei topi. Sci Transl Med 6(217):217ra212

Bryant CD (2011) Le benedizioni e le maledizioni dei sottoceppi C57BL/6 negli studi genetici sui topi. Ann N Y Acad Sci 1245:31-33. https://doi.org/10.1111/j.1749-6632.2011.06325.x

Burd CE, Sorrentino JA, Clark KS, Darr DB, Krishnamurthy J, Deal AM, Bardeesy N, Castrillon DH, Beach DH, Sharpless NE (2013) Monitoraggio della tumorigenesi e della senescenza in vivo con un modello p16 (INK4a) -luciferasi. Cella 152(1–2):340–351. https://doi.org/10.1016/j.cell.2012.12.010

Cancer IafRo (2019) WHO Classifications of tumors Editorial Board, vol 2. WHO Classification of tumor series, 5th edn

Caruso JA, Akli S, Pageon L, Hunt KK, Keyomarsi K (2015) L'inibitore della serina proteasi elafin mantiene il normale controllo della crescita opponendosi agli effetti mitogeni dell'elastasi neutrofila. Oncogene 34(27):3556–3567. https://doi.org/10.1038/onc.2014.284

Cheung KJ, Gabrielson E, Werb Z, Ewald AJ (2013) L'invasione collettiva nel cancro al seno richiede un programma epiteliale basale conservato. Cella 155(7):1639–1651. https://doi.org/10.1016/j.cell.2013.11.029

Christenson JL, Butterfield KT, Spoelstra NS, Norris JD, Josan JS, Pollock JA, McDonnell DP, Katzenellenbogen BS, Katzenellenbogen JA, Richer JK (2017) MMTV-PyMT e cellule tumorali mammarie di topo Met-1 derivate come modelli per lo studio del ruolo del recettore degli androgeni nella progressione del carcinoma mammario triplo negativo. Cancro di Horm 8 (2): 69-77. https://doi.org/10.1007/s12672-017-0285-6

Coimbra-Campos LMC, Silva WN, Baltazar LM, Costa PAC, Prazeres PHDM, Picoli CC, Costa AC, Rocha BGS, Santos GSP, Oliveira FMS, Pinto MCX, Amorim JH, Azevedo VAC, Souza DG, Russo RC, Resende RR, Mintz A, Birbrair A (2021) Le cellule circolanti Nestin-GFP+ partecipano alla patogenesi del Paracoccidioides brasiliensis nei polmoni. Recensioni e rapporti sulle cellule staminali. https://doi.org/10.1007/s12015-021-10181-3

Colpaert C, Vermeulen P, Jeuris W, van Beest P, Goovaerts G, Weyler J, Van Dam P, Dirix L, Van Marck E (2001) La recidiva precoce a distanza nei pazienti con cancro al seno "nodo-negativo" non è prevista dall'ascellare occulto metastasi linfonodali, ma dalle caratteristiche del tumore primario. J Pathol 193(4):442–449. https://doi.org/10.1002/path.829

Colpaert CG, Vermeulen PB, Fox SB, Harris AL, Dirix LY, Van Marck EA (2003) La presenza di un focus fibrotico nel carcinoma mammario invasivo è correlata con l'espressione dell'anidrasi carbonica IX ed è un marker di ipossia e prognosi infausta. Trattamento per la cura del cancro al seno 81 (2): 137-147. https://doi.org/10.1023/A:1025702330207

Cox TR, Erler JT (2011) Rimodellamento e omeostasi della matrice extracellulare: implicazioni per le malattie fibrotiche e il cancro. Dis Modello Mech 4 (2): 165-178. https://doi.org/10.1242/dmm.004077

Daniels SR, Liyasova M, Kales SC, Nau MM, Ryan PE, Green JE, Lipkowitz S (2019) Perdita di funzione Mutazioni Cbl-c nei tumori solidi. PLoS UNO 14(7):e0219143. https://doi.org/10.1371/journal.pone.0219143

Davie SA, Maglione JE, Manner CK, Young D, Cardiff RD, MacLeod CL, Ellies LG (2007) Effetti degli sfondi del ceppo FVB/NJ e C57Bl/6J sul fenotipo del tumore mammario in topi inducibili con deficit di ossido nitrico sintasi. Res transgenica 16 (2): 193-201. https://doi.org/10.1007/s11248-006-9056-9

de Mingo PA, Gardner A, Hiebler S, Soliman H, Rugo HS, Krummel MF, Coussens LM, Ruffell B (2018) TIM-3 regola la funzione delle cellule dendritiche CD103(+) e la risposta alla chemioterapia nel cancro al seno. Cellula cancerosa 33(1):60-74 e66. https://doi.org/10.1016/j.ccell.2017.11.019

de Visser KE, Eichten A, Coussens LM (2006) Ruoli paradossali del sistema immunitario durante lo sviluppo del cancro. Nat Rev Cancer 6 (1): 24-37. https://doi.org/10.1038/nrc1782

Deeb KK, Michalowska AM, Yoon CY, Krummey SM, Hoenerhoff MJ, Kavanaugh C, Li MC, Demayo FJ, Linnoila I, Deng CX, Lee EY, Medina D, Shih JH, Green JE (2007) Identificazione di un SV40 T integrato Firma del cancro dell'antigene /t nei carcinomi umani aggressivi della mammella, della prostata e del polmone con prognosi infausta. Cancer Res 67(17):8065–8080. https://doi.org/10.1158/0008-5472.CAN-07-1515

Dehdashti F, Wu N, Ma CX, Naughton MJ, Katzenellenbogen JA, Siegel BA (2021) Associazione del test di sfida dell'estradiolo basato su PET per i recettori del progesterone del cancro al seno con risposta alla terapia endocrina. Nat Comune 12(1):733. https://doi.org/10.1038/s41467-020-20814-9

DeNardo DG, Coussens LM (2007) Infiammazione e cancro al seno. Bilanciamento della risposta immunitaria: diafonia tra cellule immunitarie adattative e innate durante la progressione del cancro al seno. Ris. cancro al seno 9 (4): 212. https://doi.org/10.1186/bcr1746

DeNardo DG, Barreto JB, Andreu P, Vasquez L, Tawfik D, Kolhatkar N, Coussens LM (2009) Le cellule T CD4(+) regolano le metastasi polmonari dei carcinomi mammari migliorando le proprietà protumorali dei macrofagi. Cellula cancerosa 16 (2): 91-102. https://doi.org/10.1016/j.ccr.2009.06.018

Dirat B, Bochet L, Dabek M, Daviaud D, Dauvillier S, Majed B, Wang YY, Meulle A, Salles B, Le Gonidec S, Garrido I, Escourrou G, Valet P, Muller C (2011) Esibizione di adipociti associati al cancro un fenotipo attivato e contribuiscono all'invasione del cancro al seno. Cancer Res 71 (7): 2455-2465. https://doi.org/10.1158/0008-5472.CAN-10-3323

dos Santos CO, Rebbeck C, Rozhkova E, Valentine A, Samuels A, Kadiri LR, Osten P, Harris EY, Uren PJ, Smith AD, Hannon GJ (2013) La gerarchia molecolare della differenziazione mammaria produce marcatori raffinati delle cellule staminali mammarie. Proc Natl Acad Sci USA 110(18):7123–7130. https://doi.org/10.1073/pnas.1303919110

Dravis C, Chung CY, Lytle NK, Herrera-Valdez J, Luna G, Trejo CL, Reya T, Wahl GM (2018) Il profilo epigenetico e trascrittomico dello sviluppo della ghiandola mammaria e i modelli tumorali rivelano i regolatori della plasticità dello stato cellulare. Cellula cancerosa 34(3):466-482 e466. https://doi.org/10.1016/j.ccell.2018.08.001

Duncan JS, Whittle MC, Nakamura K, Abell AN, Midland AA, Zawistowski JS, Johnson NL, Granger DA, Jordan NV, Darr DB, Usary J, Kuan PF, Smalley DM, Major B, He X, Hoadley KA, Zhou B , Sharpless NE, Perou CM, Kim WY, Gomez SM, Chen X, Jin J, Frye SV, Earp HS, Graves LM, Johnson GL (2012) Riprogrammazione dinamica del kinome in risposta all'inibizione mirata di MEK nel carcinoma mammario triplo negativo . Cella 149(2):307–321. https://doi.org/10.1016/j.cell.2012.02.053

Duong MN, Geneste A, Fallone F, Li X, Dumontet C, Muller C (2017) Il grasso e il cattivo: adipociti maturi, attori chiave nella progressione e resistenza del tumore. Oncotarget 8(34):57622–57641. https://doi.org/10.18632/oncotarget.18038

Edechi CA, Ikeogu N, Uzonna JE, Myal Y (2019) Regolazione dell'immunità nel cancro al seno. Tumori (Basilea). https://doi.org/10.3390/cancers11081080

Egeblad M, Rasch MG, Weaver VM (2010) Interazione dinamica tra l'impalcatura di collagene e l'evoluzione del tumore. Curr Opin Cell Biol 22(5):697–706. https://doi.org/10.1016/j.ceb.2010.08.015

Fang F, Turcan S, Rimner A, Kaufman A, Giri D, Morris LG, Shen R, Seshan V, Mo Q, Heguy A, Baylin SB, Ahuja N, Viale A, Massague J, Norton L, Vahdat LT, Moynahan ME , Chan TA (2011) I metilomi del cancro al seno stabiliscono una base epigenomica per le metastasi. Sci Transl Med 3(75):75ra25

Fantozzi A, Christofori G (2006) Modelli murini di metastasi del cancro al seno. Ris. cancro al seno 8(4):212. https://doi.org/10.1186/bcr1530

Feeley LP, Mulligan AM, Pinnaduwage D, Bull SB, Andrulis IL (2014) La distinzione dei sottotipi di cancro al seno luminale per Ki67, recettore del progesterone o stato TP53 fornisce informazioni prognostiche. Mod Pathol 27 (4): 554–561. https://doi.org/10.1038/modpathol.2013.153

Fitzgibbons PL, Page DL, Weaver D, Thor AD, Allred DC, Clark GM, Ruby SG, O'Malley F, Simpson JF, Connolly JL, Hayes DF, Edge SB, Lichter A, Schnitt SJ (2000) Fattori prognostici nel seno cancro. Dichiarazione di consenso del College of American Pathologists 1999. Arch Pathol Lab Med 124(7):966–978

Forouzanfar MH, Foreman KJ, Delossantos AM, Lozano R, Lopez AD, Murray CJ, Naghavi M (2011) Cancro al seno e al collo dell'utero in 187 paesi tra il 1980 e il 2010: un'analisi sistematica. Lancet 378(9801): 1461–1484. https://doi.org/10.1016/S0140-6736(11)61351-2

Fuseler JW, Robichaux JP, Atiyah HI, Ramsdell AF (2014) L'analisi della dimensione morfometrica e frattale identifica i primi cambiamenti neoplastici nell'epitelio mammario dei topi MMTV-cNeu. Antitumorale Ris 34(3):1171-1177

Gamba CO, Damasceno KA, Ferreira IC, Rodrigues MA, Gomes DA, Alves MR, Rocha RM, Lima AE, Ferreira E, Cassali GD (2019) Lo studio della repressione trascrizionale mediata da ZEB2 nel carcinoma micropapillare invasivo del cane nella ghiandola mammaria. PLoS UNO 14(1):e0209497. https://doi.org/10.1371/journal.pone.0209497

Garrido-Castro AC, Lin NU, Polyak K (2019) Approfondimenti sulle classificazioni molecolari del carcinoma mammario triplo negativo: migliorare la selezione dei pazienti per il trattamento. Cancro Discov 9(2):176–198. https://doi.org/10.1158/2159-8290.CD-18-1177

Gasco M, Shami S, Crook T (2002) Il percorso p53 nel cancro al seno. Cancro al seno Res 4 (2): 70-76. https://doi.org/10.1186/bcr426

Georgess D, Padmanaban V, Sirka OK, Coutinho K, Choi A, Frid G, Neumann NM, Inoue T, Ewald AJ (2020) La diffusione epiteliale indotta da Twist1 richiede la segnalazione Prkd1. Cancer Res 80(2):204–218. https://doi.org/10.1158/0008-5472.CAN-18-3241

Gil Del Alcazar CR, Huh SJ, Ekram MB, Trinh A, Liu LL, Beca F, Zi X, Kwak M, Bergholtz H, Su Y, Ding L, Russnes HG, Richardson AL, Babski K, Min Hui Kim E, McDonnell CH 3rd, Wagner J, Rowberry R, ​​Freeman GJ, Dillon D, Sorlie T, Coussens LM, Garber JE, Fan R, Bobolis K, Allred DC, Jeong J, Park SY, Michor F, Polyak K (2017) Immune escape in carcinoma mammario durante la transizione da carcinoma in situ a carcinoma invasivo. Cancro Discov 7(10):1098-1115. https://doi.org/10.1158/2159-8290.CD-17-0222

Giles ED, Wellberg EA (2020) Modelli preclinici per studiare l'obesità e il cancro al seno nelle donne: considerazioni, avvertimenti e strumenti. J Neoplasia della ghiandola mammaria 25(4):237–253. https://doi.org/10.1007/s10911-020-09463-2

Goonewardene TI, Sowter HM, Harris AL (2002) Percorsi indotti dall'ipossia nel cancro al seno. Microsc Res Tech 59(1):41–48. https://doi.org/10.1002/jemt.10175

Grove E, Eckardt S, McLaughlin KJ (2016) Incrocio di topo ad alta velocità attraverso la linea germinale femminile. PLoS UNO 11(12):e0166822. https://doi.org/10.1371/journal.pone.0166822

Guerrini L, Costanzo A, Merlo GR (2011) Una sinfonia di regolamenti centrata su p63 per controllare lo sviluppo delle strutture derivate dall'ectoderma. J Biomed Biotechnol 2011:864904. https://doi.org/10.1155/2011/864904

Hammond ME, Hayes DF, Dowsett M, Allred DC, Hagerty KL, Badve S, Fitzgibbons PL, Francis G, Goldstein NS, Hayes M, Hicks DG, Lester S, Love R, Mangu PB, McShane L, Miller K, Osborne CK , Paik S, Perlmutter J, Rhodes A, Sasano H, Schwartz JN, Sweep FC, Taube S, Torlakovic EE, Valenstein P, Viale G, Visscher D, Wheeler T, Williams RB, Wittliff JL, Wolff AC (2010) American Society of Clinical Oncology/College Of American Pathologists raccomandazioni delle linee guida per i test immunoistochimici dei recettori degli estrogeni e del progesterone nel cancro al seno. J Clin Oncol 28(16):2784–2795. https://doi.org/10.1200/JCO.2009.25.6529

Hanahan D, Weinberg RA (2011) Caratteristiche del cancro: la prossima generazione. Cella 144(5):646–674. https://doi.org/10.1016/j.cell.2011.02.013

Harbeck N, Penault-Llorca F, Cortes J, Gnant M, Houssami N, Poortmans P, Ruddy K, Tsang J, Cardoso F (2019) Cancro al seno. Nat Rev Dis Primers 5 (1): 66. https://doi.org/10.1038/s41572-019-0111-2

Hasebe T, Tsuda H, Hirohashi S, Shimosato Y, Iwai M, Imoto S, Mukai K (1996) Focus fibrotico nel carcinoma duttale invasivo: un indicatore di elevata aggressività tumorale. Jpn J Cancer Res 87(4):385–394. https://doi.org/10.1111/j.1349-7006.1996.tb00234.x

Hasebe T, Tsuda H, Hirohashi S, Shimosato Y, Tsubono Y, Yamamoto H, Mukai K (1998) Focus fibrotico nel carcinoma duttale infiltrante della mammella: un parametro prognostico istopatologico significativo per predire la sopravvivenza a lungo termine dei pazienti. Trattamento per la cura del cancro al seno 49 (3): 195-208. https://doi.org/10.1023/a:106067513634

He D, Mustafi D, Fan X, Fernandez S, Markiewicz E, Zamora M, Mueller J, Sachleben JR, Brady MJ, Conzen SD, Karczmar GS (2018) La spettroscopia a risonanza magnetica rileva la composizione lipidica differenziale nelle ghiandole mammarie su basso contenuto di grassi, alto grassi animali contro diete ad alto contenuto di fruttosio. PLoS UNO 13(1):e0190929. https://doi.org/10.1371/journal.pone.0190929

Heilmann K, Toth R, Bossmann C, Klimo K, Plass C, Gerhauser C (2017) Lo schermo a livello di genoma per RNA non codificanti lunghi differenzialmente metilati identifica Esrp2 e lncRNA Esrp2-come regolato dalla metilazione del DNA del potenziatore con rilevanza prognostica per il cancro al seno umano. Oncogene 36(46):6446–6461. https://doi.org/10.1038/onc.2017.246

Holen I, Speirs V, Morrissey B, Blyth K (2017) Modelli in vivo nella ricerca sul cancro al seno: progressi, sfide e direzioni future. Dis Modello Mech 10(4):359–371. https://doi.org/10.1242/dmm.028274

Hollern DP, Andrechek ER (2014) Un'analisi genomica dei modelli murini di cancro al seno rivela le caratteristiche molecolari dei modelli murini e le relazioni con il cancro al seno umano. Ricerca sul cancro al seno 16 (3): R59. https://doi.org/10.1186/bcr3672

Hou Z, Zhang Y (2019) Inserimento del DNA con CRISPR. Scienza 365 (6448): 25-26. https://doi.org/10.1126/science.aay2056

Huang Y, Ma C, Zhang Q, Ye J, Wang F, Zhang Y, Hunborg P, Varvares MA, Hoft DF, Hsueh EC, Peng G (2015) Le cellule T CD4+ e CD8+ hanno ruoli opposti nella progressione e nell'esito del cancro al seno. Oncotarget 6(19):17462–17478. https://doi.org/10.18632/oncotarget.3958

Khan JA, Mendelson A, Kunisaki Y, Birbrair A, Kou Y, Arnal-Estape A, Pinho S, Ciero P, Nakahara F, Ma'ayan A, Bergman A, Merad M, Frenette PS (2016) Cellule staminali ematopoietiche del fegato fetale nicchie associate a vasi portali. Scienza 351(6269):176–180. https://doi.org/10.1126/science.aad0084

Korinek V (2020) Numero speciale: modellazione animale nel cancro. Geni (Basilea) https://doi.org/10.3390/genes11091009

Koyama T, Hasebe T, Tsuda H, Hirohashi S, Sasaki S, Fukutomi T, Imoto S, Umeda T, Mukai K (1999) Fattori istologici associati alle metastasi ossee iniziali del carcinoma duttale invasivo della mammella. Jpn J Cancer Res 90(3):294–300. https://doi.org/10.1111/j.1349-706.1999.tb00747.x

Kriegsmann M, Endris V, Wolf T, Pfarr N, Stenzinger A, Loibl S, Denkert C, Schneeweiss A, Budczies J, Sinn P, Weichert W (2014) I profili mutazionali nel carcinoma mammario triplo negativo definiti dal sequenziamento multigene ultraprofondo mostrano alti tassi di alterazioni del percorso PI3K e differenze specifiche di sottogruppi di entità clinicamente rilevanti. Oncotarget 5(20):9952–9965. https://doi.org/10.18632/oncotarget.2481

Lengyel E, Makowski L, DiGiovanni J, Kolonin MG (2018) Il cancro come una questione di grasso: il crosstalk tra tessuto adiposo e tumori. Tendenze Cancro 4(5):374-384. https://doi.org/10.1016/j.trecan.2018.03.004

Lester SC, Bose S, Chen YY, Connolly JL, de Baca ME, Fitzgibbons PL, Hayes DF, Kleer C, O'Malley FP, Page DL, Smith BL, Tan LK, Weaver DL, Winer E, membri del Cancer Committee CoAP (2009) Protocollo per l'esame di campioni di pazienti con carcinoma invasivo della mammella. Arch Pathol Lab Med 133(10)::1515–1538. https://doi.org/10.1043/1543-2165-133.10.1515

Liao D, Luo Y, Markowitz D, Xiang R, Reisfeld RA (2009) I fibroblasti associati al cancro promuovono la crescita e la metastasi del tumore modulando il microambiente immunitario del tumore in un modello di cancro al seno murino 4T1. PLoS UNO 4(11):e7965. https://doi.org/10.1371/journal.pone.0007965

Linder CC (2006) Variabili genetiche che influenzano il fenotipo. ILAR J 47(2):132–140. https://doi.org/10.1093/ilar.47.2.132

Liu ML, Von Lintig FC, Liyanage M, Shibata MA, Jorcyk CL, Ried T, Boss GR, Green JE (1998) Amplificazione di Ki-ras ed elevazione dell'attività della chinasi MAP durante la progressione del tumore mammario nel tag C3 (1)/SV40 topi transgenici. Oncogene 17(18):2403-2411. https://doi.org/10.1038/sj.onc.1202456

Liu R, Varghese S, Rabkin SD (2005) Terapia vettoriale del virus dell'herpes simplex oncolitico del cancro al seno in topi transgenici con antigene T C3 (1) / SV40. Cancer Res 65(4):1532–1540. https://doi.org/10.1158/0008-5472.CAN-04-3353

Lonning PE (2007) Prognosi e previsione del cancro al seno: stiamo facendo progressi? Ann Oncol 18(Suppl 8):viii3-7. https://doi.org/10.1093/annonc/mdm260

MacLennan MB, Anderson BM, Ma DW (2011) Sviluppo differenziale della ghiandola mammaria nei topi FVB e C57Bl/6: implicazioni per la ricerca sul cancro al seno. Nutrienti 3(11):929–936. https://doi.org/10.3390/nu3110929

Markel P, Shu P, Ebeling C, Carlson GA, Nagle DL, Smutko JS, Moore KJ (1997) Problemi teorici ed empirici per l'allevamento assistito da marcatori di ceppi di topi congenici. Nat Genet 17 (3): 280-284. https://doi.org/10.1038/ng1197-280

Maroulakou IG, Anver M, Garrett L, Green JE (1994) Adenocarcinoma prostatico e mammario in topi transgenici che trasportano un gene di fusione dell'antigene tumorale 40 del virus delle scimmie di ratto C3 (1). Proc Natl Acad Sci USA 91(23):11236–11240

Martin-Pardillos A, Valls Chiva A, Bande Vargas G, Hurtado Blanco P, Pineiro Cid R, Guijarro PJ, Hummer S, Bejar Serrano E, Rodriguez-Casanova A, Diaz-Lagares A, Castellvi J, Miravet-Verde S, Serrano L, Lluch-Senar M, Sebastian V, Bribian A, Lopez-Mascaraque L, Lopez-Lopez R, Ramon YCS (2019) Il ruolo della comunicazione clonale e dell'eterogeneità nel cancro al seno. Cancro BMC 19 (1): 666. https://doi.org/10.1186/s12885-019-5883-y

Maughan KL, Lutterbie MA, Ham PS (2010) Trattamento del cancro al seno. Am Fam Physician 81(11):1339–1346

McPhail LD, Robinson SP (2010) Imaging RM suscettibilità intrinseca di tumori mammari di ratto indotti chimicamente: relazione con la valutazione istologica dell'ipossia e della fibrosi. Radiologia 254 (1): 110-118. https://doi.org/10.1148/radiol.2541090395

Medri L, Volpi A, Nanni O, Vecci AM, Mangia A, Schittulli F, Padovani F, Giunchi DC, Zito A, Amadori D, Paradiso A, Silvestrini R (2003) Rilevanza prognostica dell'attività mitotica in pazienti con seno linfonodale cancro. Mod Pathol 16(11):1067–1075. https://doi.org/10.1097/01.MP.0000093625.20366.9D

Meyer-Losic F, Newman SP, Day JM, Reed MJ, Kasprzyk PG, Purohit A, Foster PA (2013) STX140, ma non paclitaxel, inibisce l'inizio e la progressione del tumore mammario nel transgenico C3(1)/SV40 T/t-antigene i topi. PLoS UNO 8(12):e80305. https://doi.org/10.1371/journal.pone.0080305

Nissen NI, Karsdal M, Willumsen N (2019) Collageni e fibroblasti associati al cancro nello stroma reattivo e la sua relazione con la biologia del cancro. J Exp Clin Cancer Res 38(1):115. https://doi.org/10.1186/s13046-019-1110-6

Nobre AR, Risson E, Singh DK, Martino JD, Cheung JF, Wang J, Johnson J, Russnes HG, Bravo-Cordero JJ, Birbrair A, Naume B, Azhar M, Frenette PS, Aguirre-Ghiso J (2021) Midollo osseo Le cellule staminali mesenchimali NG2+/Nestin+ guidano la dormienza DTC tramite TGFβ2. Cancro della natura 2:327-339

Ognjenovic NB, Bagheri M, Mohamed GA, Xu K, Chen Y, Mohamed Saleem MA, Brown MS, Nagaraj SH, Muller KE, Gerber SA, Christensen BC, Pattabiraman DR (2020) Limitazione dell'autorinnovamento del compartimento basale mediante attivazione della PKA induce la differenziazione e altera l'evoluzione dei tumori mammari. Cella di sviluppo 55(5):544-557 e546. https://doi.org/10.1016/j.devcel.2020.10.004

O'Toole SA, Machalek DA, Shearer RF, Millar EK, Nair R, Schofield P, McLeod D, Cooper CL, McNeil CM, McFarland A, Nguyen A, Ormandy CJ, Qiu MR, Rabinovich B, Martelotto LG, Vu D, Hannigan GE, Musgrove EA, Christ D, Sutherland RL, Watkins DN, Swarbrick A (2011) La sovraespressione di Hedgehog è associata a interazioni stromali e prevede scarsi risultati nel cancro al seno. Cancer Res 71(11):4002–4014. https://doi.org/10.1158/0008-5472.CAN-10-3738

Padmanaban V, Krol I, Suhail Y, Szczerba BM, Aceto N, Bader JS, Ewald AJ (2019) La caderina elettronica è necessaria per le metastasi in più modelli di cancro al seno. Natura 573(7774):439–444. https://doi.org/10.1038/s41586-019-1526-3

Park J, Wysocki RW, Amoozgar Z, Maiorino L, Fein MR, Jorns J, Schott AF, Kinugasa-Katayama Y, Lee Y, Won NH, Nakasone ES, Hearn SA, Kuttner V, Qiu J, Almeida AS, Perurena N, Kessenbrock K, Goldberg MS, Egeblad M (2016) Le cellule tumorali inducono trappole di DNA extracellulare dei neutrofili che supportano la metastasi. Sci Transl Med 8(361):361ra138. https://doi.org/10.1126/scitranslmed.aag1711

Park MK, Lee CH, Lee H (2018) Modelli murini di cancro al seno nella ricerca preclinica. Lab Anim Ris 34(4):160-165. https://doi.org/10.5625/lar.2018.34.4.160

Pathania R, Ramachandran S, Elangovan S, Padia R, Yang P, Cinghu S, Veeranan-Karmegam R, Arjunan P, Gnana-Prakasam JP, Sadanand F, Pei L, Chang CS, Choi JH, Shi H, Manicassamy S, Prasad PD, Sharma S, Ganapathy V, Jothi R, Thangaraju M (2015) DNMT1 è essenziale per il mantenimento e la tumorigenesi delle cellule staminali mammarie e tumorali. Nat Comune 6:6910. https://doi.org/10.1038/nmms7910

Perou CM, Sorlie T, Eisen MB, van de Rijn M, Jeffrey SS, Rees CA, Pollack JR, Ross DT, Johnsen H, Akslen LA, Fluge O, Pergamenschikov A, Williams C, Zhu SX, Lonning PE, Borresen-Dale AL, Brown PO, Botstein D (2000) Ritratti molecolari di tumori al seno umano. Natura 406(6797):747–752. https://doi.org/10.1038/35021093

Petruzzelli M, Schweiger M, Schreiber R, Campos-Olivas R, Tsoli M, Allen J, Swarbrick M, Rose-John S, Rincon M, Robertson G, Zechner R, Wagner EF (2014) Un passaggio dal grasso bianco a quello bruno aumenta dispendio energetico nella cachessia associata al cancro. Cella Metab 20(3):433–447. https://doi.org/10.1016/j.cmet.2014.06.011

Pfefferle AD, Herschkowitz JI, Usary J, Harrell JC, Spike BT, Adams JR, Torres-Arzayus MI, Brown M, Egan SE, Wahl GM, Rosen JM, Perou CM (2013) Classificazione trascrittomica di modelli murini di cancro al seno geneticamente modificati identifica le controparti del sottotipo umano. Genoma Biol 14(11):R125. https://doi.org/10.1186/gb-2013-14-11-r125

Pietilainen T, Lipponen P, Aaltomaa S, Eskelinen M, Kosma VM, Syrjanen K (1996) L'importante valore prognostico dell'espressione di Ki-67 determinato dall'analisi delle immagini nel cancro al seno. J Cancer Res Clin Oncol 122(11):687–692. https://doi.org/10.1007/BF01209033

Prazeres P, Leonel C, Silva WN, Rocha BGS, Santos GSP, Costa AC, Picoli CC, Sena IFG, Goncalves WA, Vieira MS, Costa PAC, Campos L, Lopes MTP, Costa MR, Resende RR, Cunha TM, Mintz A , Birbrair A (2020a) L'ablazione dei nervi sensoriali favorisce la progressione del melanoma. J Cell Mol Med. https://doi.org/10.1111/jcmm.15381

Prazeres P, Leonel C, Silva WN, Rocha BGS, Santos GSP, Costa AC, Picoli CC, Sena IFG, Goncalves WA, Vieira MS, Costa PAC, Campos L, Lopes MTP, Costa MR, Resende RR, Cunha TM, Mintz A , Birbrair A (2020b) L'ablazione dei nervi sensoriali favorisce la progressione del melanoma. J Cell Mol Med 24 (17): 9574-9589. https://doi.org/10.1111/jcmm.15381

Quail DF, Dannenberg AJ (2019) Il microambiente del tessuto adiposo obeso nello sviluppo e nella progressione del cancro. Nat Rev Endocrinol 15 (3): 139-154. https://doi.org/10.1038/s41574-018-0126-x

Rivera J, Tessarollo L (2008) Background genetico e il dilemma di tradurre gli studi sui topi nell'uomo. Immunità 28(1):1–4. https://doi.org/10.1016/j.immuni.2007.12.008

Roberts PJ, Usary JE, Darr DB, Dillon PM, Pfefferle AD, Whittle MC, Duncan JS, Johnson SM, Combest AJ, Jin J, Zamboni WC, Johnson GL, Perou CM, Sharpless NE (2012) Combinato PI3K/mTOR e MEK l'inibizione fornisce un'ampia attività antitumorale in fedeli modelli di cancro murino. Clin Cancer Res 18(19):5290–5303. https://doi.org/0.1158/1078-0432.CCR-12-0563

Ronnov-Jessen L, Petersen OW, Bissell MJ (1996) Cambiamenti cellulari coinvolti nella conversione del seno da normale a maligno: importanza della reazione stromale. Physiol Rev 76 (1): 69-125. https://doi.org/10.1152/physrev.1996.76.1.69

Ross C, Szczepanek K, Lee M, Yang H, Peer CJ, Kindrick J, Shankarappa P, Lin ZW, Sanford JD, Figg WD, Hunter KW (2020) Espressione genica specifica per metastasi in modelli di tumore mammario di topo autoctono e allotrapianto: stratificazione e identificazione di firme mirate. Mol Cancer Res 18(9):1278–1289. https://doi.org/10.1158/1541-7786.MCR-20-0046

Rowse GJ, Ritland SR, Gendler SJ (1998) Modulazione genetica della tumorigenesi mammaria indotta da proto-oncogene neu. Cancer Res 58(12):2675–2679

Ruffell B, Chang-Strachan D, Chan V, Rosenbusch A, Ho CM, Pryer N, Daniel D, Hwang ES, Rugo HS, Coussens LM (2014) Il macrofago IL-10 blocca le risposte dipendenti dalle cellule CD8+ alla chemioterapia sopprimendo IL -12 espressione in cellule dendritiche intratumorali. Cellula cancerosa 26(5):623–637. https://doi.org/10.1016/j.ccell.2014.09.06

Sakamoto K, Schmidt JW, Wagner KU (2015) Modelli murini di cancro al seno. Metodi Mol Biol 1267:47-71. https://doi.org/10.1007/978-1-4939-2297-0_3

Salgado R, Denkert C, Demaria S, Sirtaine N, Klauschen F, Pruneri G, Wienert S, Van den Eynden G, Baehner FL, Penault-Llorca F, Perez EA, Thompson EA, Symmans WF, Richardson AL, Brock J, Criscitiello C, Bailey H, Ignatiadis M, Floris G, Sparano J, Kos Z, Nielsen T, Rimm DL, Allison KH, Reis-Filho JS, Loibl S, Sotiriou C, Viale G, Badve S, Adams S, Willard-Gallo K , Loi S, International TWG (2015) La valutazione dei linfociti infiltranti il ​​tumore (TIL) nel cancro al seno: raccomandazioni di un gruppo di lavoro internazionale TIL 2014. Ann Oncol 26 (2): 259–271. https://doi.org/10.1093/annonc/mdu450

Sellers RS, Clifford CB, Treuting PM, Brayton C (2012) Variazione immunologica tra ceppi di topi di laboratorio consanguinei: punti da considerare nella fenotipizzazione di topi geneticamente immunomodificati. Vet Pathol 49 (1): 32-43. https://doi.org/10.1177/0300985811429314

Shay T, Jojic V, Zuk O, Rothamel K, Puyraimond-Zemmour D, Feng T, Wakamatsu E, Benoist C, Koller D, Regev A, ImmGen C (2013) Conservazione e divergenza nei programmi trascrizionali dell'immunità umana e murina sistemi. Proc Natl Acad Sci USA 110(8):2946–2951. https://doi.org/10.1073/pnas.1222738110

Shibata MA, Maroulakou IG, Jorcyk CL, Gold LG, Ward JM, Green JE (1996) apoptosi indipendente da p53 durante la progressione del tumore mammario in topi transgenici con antigene T grande C3(1)/SV40: soppressione dell'apoptosi durante la transizione da preneoplasia a carcinoma. Cancer Res 56(13):2998–3003

Shibata MA, Jorcyk CL, Liu ML, Yoshidome K, Gold LG, Green JE (1998) Il modello murino transgenico dell'antigene C3 (1)/SV40 T di cancro alla prostata e al seno. Toxicol Pathol 26 (1): 177-182. https://doi.org/10.1177/019262339802600121

Singh P, Schimenti JC, Bolcun-Filas E (2015) Guida pratica di un genetista di topi alle applicazioni CRISPR. Genetica 199(1):1–15. https://doi.org/10.1534/genetics.114.169771

Sohail A, Khan A, Wahab N, Zameer A, Khan S (2021) Un quadro di rilevamento della mitosi basato sulla CNN profonda multifase per le immagini istopatologiche del cancro al seno. Rappresentazione fantascientifica 11(1):6215. https://doi.org/10.1038/s41598-021-85652-1

Song HK, Hwang DY (2017) Uso dei topi C57BL/6N sulla varietà delle ricerche immunologiche. Lab Anim Ris 33(2):119–123. https://doi.org/10.5625/lar.2017.33.2.119

Song W, Hwang Y, Youngblood VM, Cook RS, Balko JM, Chen J, Brantley-Sieders DM (2017) Il targeting per EphA2 compromette la progressione del ciclo cellulare e la crescita dei tumori al seno di tipo basale / triplo negativo. Oncogene 36(40):5620-5630. https://doi.org/10.1038/onc.2017.170

Souza CM, Gamba Cde O, Campos CB, Lopes MT, Ferreira MA, Andrade SP, Cassali GD (2013) Il carboplatino ritarda la crescita del cancro mammario 4T1 nei topi. Pathol Res Pract 209(1):24–29. https://doi.org/10.1016/j.prp.2012.10.003

Sundaram S, Freemerman AJ, Galanko JA, McNaughton KK, Bendt KM, Darr DB, Troester MA, Makowski L (2014) La regolazione mediata dall'obesità di HGF/c-Met è associata a una ridotta latenza del cancro al seno basale nei topi parosi. PLoS UNO 9(10):e111394. https://doi.org/10.1371/journal.pone.0111394

Takao K, Miyakawa T (2015) Le risposte genomiche nei modelli murini imitano notevolmente le malattie infiammatorie umane. Proc Natl Acad Sci USA 112(4):1167–1172. https://doi.org/10.1073/pnas.1401965111

Taketo M, Schroeder AC, Mobraaten LE, Gunning KB, Hanten G, Fox RR, Roderick TH, Stewart CL, Lilly F, Hansen CT et al (1991) FVB/N: un ceppo di topo consanguineo preferibile per le analisi transgeniche. Proc Natl Acad Sci USA 88(6):2065–2069. https://doi.org/10.1073/pnas.88.6.2065

Tatum JL, Kelloff GJ, Gillies RJ, Arbeit JM, Brown JM, Chao KS, Chapman JD, Eckelman WC, Fyles AW, Giaccia AJ, Hill RP, Koch CJ, Krishna MC, Krohn KA, Lewis JS, Mason RP, Melillo G , Padhani AR, Powis G, Rajendran JG, Reba R, Robinson SP, Semenza GL, Swartz HM, Vaupel P, Yang D, Croft B, Hoffman J, Liu G, Stone H, Sullivan D (2006) Ipossia: importanza nel tumore biologia, misurazione non invasiva mediante imaging e valore della sua misurazione nella gestione della terapia del cancro. Int J Radiat Biol 82(10):699-757. https://doi.org/10.1080/09553000601002324

Teixido J, Hidalgo A, Fagerholm S (2019) Editoriale: traffico di leucociti nell'omeostasi e nella malattia. Immunolo anteriore 10:2560. https://doi.org/10.3389/fimmu.2019.02560

Tiwari P, Blank A, Cui C, Schoenfelt KQ, Zhou G, Xu Y, Khramtsova G, Olopade F, Shah AM, Khan SA, Rosner MR, Becker L (2019) I macrofagi del tessuto adiposo attivati ​​metabolicamente collegano l'obesità al seno triplo negativo cancro. J Exp Med 216(6):1345–1358. https://doi.org/10.1084/jem.20181616

Van den Eynden GG, Colpaert CG, Couvelard A, Pezzella F, Dirix LY, Vermeulen PB, Van Marck EA, Hasebe T (2007) Un focus fibrotico è un fattore prognostico e un marker surrogato per l'ipossia e la (linfa)angiogenesi nel cancro al seno : revisione della letteratura e proposta sui criteri di valutazione. Istopatologia 51(4):440–451. https://doi.org/10.1111/j.1365-2559.2007.02761.x

van Diest PJ, Baak JP, Matze-Cok P, Wisse-Brekelmans EC, van Galen CM, Kurver PH, Bellot SM, Fijnheer J, van Gorp LH, Kwee WS et al (1992) Riproducibilità del conteggio della mitosi in 2.469 campioni di cancro al seno : risultati del Progetto Carcinoma Mammario Morfometrico Multicentrico. Hum Pathol 23(6):603–607. https://doi.org/10.1016/0046-8177(92)90313-r

van Diest PJ, Brugal G, Baak JP (1998) Marcatori di proliferazione nei tumori: interpretazione e valore clinico. J Clin Pathol 51(10):716–724. https://doi.org/10.1136/jcp.51.10.716

Vandeweyer E, Hertens D (2002) Quantificazione di ghiandole e grasso nel tessuto mammario: una determinazione sperimentale. Ann Anat 184 (2): 181-184. https://doi.org/10.1016/S0940-9602(02)80016-4

Vitosevic K, Todorovic M, Varljen T, Slovic Z, Matic S, Todorovic D (2018) Effetto della fissazione in formalina sull'amplificazione PCR del DNA isolato da tessuti autoptici sani. Acta Histochem 120(8):780-788. https://doi.org/10.1016/j.acthis.2018.09.005

Wagner KU (2004) Modelli di cancro al seno: quo vadis, modelli animali? Cancro al seno Ris. 6 (1): 31-38. https://doi.org/10.1186/bcr723

Weinstock A, Moura Silva H, Moore KJ, Schmidt AM, Fisher EA (2020) Eterogeneità dei leucociti nel tessuto adiposo, inclusa l'obesità. Circ Ris 126(11)::1590-1612. https://doi.org/10.1161/CIRCRESAHA.120.316203

Wetsel RA, Fleischer DT, Haviland DL (1990) Deficit del quinto componente murino del complemento (C5). Una delezione di 2 coppie di basi in un esone 5'. J Biol chimico 265 (5): 2435–2440

Wild R, Yokoyama Y, Dings RP, Ramakrishnan S (2004) Il coniugato di tossina VEGF-DT385 inibisce lo sviluppo dell'adenocarcinoma mammario in un modello murino transgenico di tumorigenesi spontanea. Trattamento Res Cancro al Seno 85(2):161–171. https://doi.org/10.1023/B:BREA.0000025407.02896.ec

Wiseman BS, Werb Z (2002) Effetti stromali sullo sviluppo della ghiandola mammaria e sul cancro al seno. Scienza 296(5570):1046–1049. https://doi.org/10.1126/science.1067431

Wolff AC, Hammond ME, Hicks DG, Dowsett M, McShane LM, Allison KH, Allred DC, Bartlett JM, Bilous M, Fitzgibbons P, Hanna W, Jenkins RB, Mangu PB, Paik S, Perez EA, Press MF, Spears PA , Vance GH, Viale G, Hayes DF, American Society of Clinical O, College of American P (2013) Raccomandazioni per il test del recettore 2 del fattore di crescita epidermico umano nel cancro al seno: aggiornamento delle linee guida per la pratica clinica dell'American Society of Clinical Oncology/College of American Pathologists . J Clin Oncol 31(31):3997–4013. https://doi.org/10.1200/JCO.2013.50.9984

Yoshidome K, Shibata MA, Couldrey C, Korach KS, Green JE (2000) L'estrogeno promuove lo sviluppo del tumore mammario in topi transgenici C3 (1)/SV40 grandi antigene T: perdita paradossale dell'espressione alfa del recettore degli estrogeni durante la progressione del tumore. Cancer Res 60(24):6901–6910

Yoshiki A, Moriwaki K (2006) Ricerca sul fenomeno del topo: implicazioni del background genetico. ILAR J 47(2):94–102. https://doi.org/10.1093/ilar.47.2.94

Zhu M, Yi M, Kim CH, Deng C, Li Y, Medina D, Stephens RM, Green JE (2011) Il profilo di espressione integrato di miRNA e mRNA dei modelli di tumore mammario del topo identifica le firme di miRNA associate al lignaggio del tumore mammario. Genoma Biol 12(8):R77. https://doi.org/10.1186/gb-2011-12-8-r77

Zhu X, Chen L, Huang B, Wang Y, Ji L, Wu J, Di G, Liu G, Yu K, Shao Z, Wang Z (2020) Il potenziale prognostico e predittivo del Ki-67 nel carcinoma mammario triplo negativo . Rappresentazione fantascientifica 10(1):225. https://doi.org/10.1038/s41598-019-57094-3


Materiali e metodi

Topi, cellule derivate da BM e linee cellulari

Cellule mononucleate murine (MNC) sono state isolate da PB o da BM (lavato dai femori) di femmine BALB/c-C3aR – / – 21 e C57B1/6 C3 –/ di 4-6 settimane di età. – topi (colonia riproduttiva acquistata dal Jackson Laboratory, Bar Harbor, ME). 17 Wild-type (wt) C57Bl/6 C3 +/+ compagni di cucciolata abbinati per età e sesso identificati mediante screening per i livelli sierici di proteina C3 nella colonia C3 –/– sono stati usati come controlli per esperimenti che esaminano topi C3 –/–. I topi BALB/c-C3aR –/–, essendo stati incrociati per 12 generazioni con topi BALB/c wt, sono stati accoppiati con topi BALB/c wt appaiati per età e sesso ottenuti dal National Cancer Institute (NCI)–Frederick ( Federico, MD). Ulteriori topi in peso C57Bl/6 e BALB/c sono stati acquistati anche dal Jackson Laboratory. Prima della sperimentazione, tutti i topi della colonia C3 –/– sono stati fenotipizzati mediante analisi del siero C3 (usando l'immunodiffusione radiale) e allo stesso modo è stata utilizzata la reazione a catena della polimerasi (PCR) per confermare il genotipo di C3aR –/–. Le MNC sono state impoverite di cellule aderenti (A - ) e quindi arricchite per MNC a densità di luce mediante centrifugazione Ficoll-Paque come descritto. 22 cellule Sca-1 + sono state isolate utilizzando minisfere paramagnetiche (Miltenyi Biotec, Auburn, CA) secondo il protocollo del produttore. La purezza delle cellule BM Sca-1 + isolate era superiore al 95% come determinato dall'analisi del selezionatore cellulare attivato dalla fluorescenza (FACS) utilizzando un FACscan (BD Biosciences Immunocytometry Systems, San Jose, CA). L'approvazione per lo studio è stata ottenuta dal comitato di revisione istituzionale dell'Università di Louisville Animal Care and Use Committee. Il consenso informato è stato fornito secondo la Dichiarazione di Helsinki.

Cellule BM umane a densità luminosa sono state ottenute da donatori volontari sani che avevano dato il consenso informato, i protocolli utilizzati sono stati approvati dai comitati di revisione istituzionali dell'Università di Louisville e della Jagellonian University. Le cellule a densità luminosa sono state impoverite di cellule aderenti e linfociti T (A – T – MNC), prima di essere arricchite per cellule CD34 + mediante selezione di immunoaffinità con sfere paramagnetiche MiniMACS (Miltenyi Biotec) come descritto in precedenza. 23 La purezza delle cellule BM CD34 + isolate era superiore al 98% come determinato mediante citometria a flusso con FACscan.

Le linee cellulari utilizzate in questo studio includevano linee cellulari ematopoietiche umane K-562, HL-60 e Jurkat, ottenute dall'American Type Culture Collection (Manassas, VA) e coltivate come descritto. 24

Mobilitazione dei topi

I topi sono stati mobilizzati mediante iniezione sottocutanea di 250 μg/kg di G-CSF umano (Amgen, Thousand Oaks, CA) al giorno per 1, 3 o 6 giorni. I topi sono stati dissanguati dal plesso retroorbitale per ottenere la conta dei leucociti utilizzando Unopette Microcollection (Becton Dickinson, Rutherford, NJ) come descritto. 9,22 A 6 ore dall'ultima iniezione di G-CSF, il PB è stato ottenuto dalla vena cava (con un ago da 25 gauge e una siringa da 1 mL contenente 250 U di eparina) e arricchito per MNC a bassa densità come descritto. 22 In alcuni protocolli di mobilizzazione è stato iniettato lo specifico antagonista C3aR SB 290157 per via intraperitoneale (0,01-1 μg/animale) come indicato nelle legende delle figure. SB 290157 è stato acquistato da Calbiochem (San Diego, CA) e risospeso in tampone fosfato salino (PBS)/dimetilsolfossido (DMSO) come descritto. 20

Citometria a flusso

Per determinare la quantità di cellule c-Kit/Sca-1 +, è stata eseguita un'analisi di citometria a flusso a due colori. In breve, 50 μL di sangue intero sono stati colorati con anticorpi monoclonali coniugati sia antitopo c-Kit fluoresceina isotiocianato (FITC) che antitopo Sca-1-ficoeritrina (PE)-coniugato (concentrazione finale 1 μg/mL sia da BD Biosciences Pharmingen, San Diego, CA). I campioni colorati con controlli isotipici appropriati (BD Biosciences Pharmingen) sono stati esaminati in parallelo. Dopo un'incubazione di 20 minuti in ghiaccio, sono stati aggiunti 2 mL di soluzione di lisi FACS (BD Biosciences Immunocytometry Systems) per lisare gli eritrociti. Successivamente le cellule sono state lavate due volte in PBS, risospese in 0,3 mL di PBS e analizzate mediante FACScan utilizzando il software CellQuest v.3.1 (BD Biosciences Immunocytometry Systems). Tipicamente, sono stati acquisiti 20.000 eventi ed è stata determinata la percentuale di cellule c-Kit/Sca-1+ per un'intera popolazione di leucociti.

Rilevazione di depositi di C3 in BM . murino

Cellule BM murine di topi C3 –/– e dei loro compagni wt sono state colorate con una miscela di peridinina proteina clorofilla-alfa (PerCP)–cianina 5 (Cy5) antitopo CD45 (BD Biosciences Pharmingen) e un'immunoglobulina G policlonale di capra purificata per affinità ( IgG) antitopo C3-Oregon Green (sotto) incubando 1 × 10 6 cellule in una diluizione ottimizzata di Ab in ghiaccio per 20 minuti, seguito da 2 lavaggi in PBS e sospensione in 0,3 mL di PBS. I dati sono stati acquisiti e analizzati mediante citometria a flusso utilizzando un software FACscan e CellQuest v3.1 (Becton Dickinson, San Jose, CA). La colorazione delle cellule BM da topi C3 –/– è stata utilizzata come controllo per qualsiasi colorazione non specifica che potrebbe essere ottenuta con il reagente C3 antitopo policlonale purificato per affinità (ad esempio, colorazione aspecifica delle cellule morte). L'anticorpo purificato per affinità (Ab) è stato generato dalla frazione IgG dell'antisiero di capra al topo C3 (Immunology Consultants, Newberg, OR) che è stato isolato mediante cromatografia liquida a proteina rapida a scambio anionico Mono-Q (FPLC) seguita da assorbimento ed eluizione da topo C3-zymosan. In breve, zymosan rivestito con C3 è stato preparato come descritto 25 utilizzando 500 mg di zymosan (Sigma Chemical, St Louis, MO) sospesi in 11 mL di siero di topo fresco e lavato 3 volte con 1 M NaCl contenente 0,1% di desossicolato di sodio (Sigma Chemical) per rimuovere proteine ​​del siero di topo non specificamente legate. Dopo 2 lavaggi con soluzione salina tamponata veronal, il C3-zymosan è stato pellettato mediante centrifugazione, sospeso uniformemente in 6 mL di IgG di capra anti-C3 (5 mg/mL) utilizzando una breve sonicazione e incubato prima a 37°C per 30 minuti e poi a 0°C per 30 minuti con agitazione vortex ad intervalli di 10 minuti per mantenere in sospensione il C3-zymosan. Per rimuovere le IgG non specificamente legate, il C3-zymosan è stato lavato 3 volte con PBS riscaldato a 37°C e poi 3 volte con 1 M NaCl contenente 0,1% di sodio desossicolato riscaldato a 37°C. L'IgG C3 antitopo è stata eluita dal C3-zymosan sospendendo in 2 mL di guanidina cloridrato 4-M e incubando a 22°C per 30 minuti. Dopo aver pellettato il C3-zymosan mediante centrifugazione, il surnatante contenente l'antitopo C3 purificato per affinità è stato dializzato 3 volte contro 1 L di PBS a 4°C. Il C3-zymosan è stato lavato 3 volte con PBS e conservato congelato a –85°C per un futuro riutilizzo. L'antitopo C3 dializzato è stato accoppiato a Oregon Green utilizzando un kit per l'etichettatura della colonna rotante secondo il protocollo del produttore (Molecular Probes, Eugene, OR). La diluizione ottimale per la colorazione delle cellule rivestite con C3 è stata determinata utilizzando cellule tumorali opsonizzate con C3 di topo e citometria a flusso e questa diluizione è stata utilizzata per colorare le cellule BM.

SB 290157 studi di tossicità

Per i test di proliferazione/sopravvivenza cellulare, MNC BM murine o umane, cellule CD34 + umane, nonché linee cellulari ematopoietiche K-562, HL-60 e Jurkat umane sono state incubate con SB 290157 (0-5 μg/mL) per 6 ore a 37°C. Le MNC BM sono state quindi piastrate in colture di metilcellulosa prive di siero in presenza di fattore stimolante le colonie di granulociti-macrofagi (GM-CSF) + interleuchina-3 (IL-3) per colonie di unità formanti colonie-macrofagi di granulociti (CFU-GM) , eritropoietina (EPO) + fattore delle cellule staminali (SCF) per colonie formanti unità eritroidi (BFU-E) e trombopoietina (TPO) per colonie CFU-megacariocitiche (Meg) come descritto. 23 Utilizzando un microscopio invertito, le colonie ematopoietiche murine sono state valutate il giorno 7 e le colonie ematopoietiche umane il giorno 12. Le linee cellulari sono state coltivate per 7 giorni consecutivi. La proliferazione delle linee cellulari è stata analizzata utilizzando il dosaggio del metil tiazolil tetrazolio (MTT), 26 e la colorazione dell'Annessina V (R&D Systems, Minneapolis, MN) e l'esclusione del tripan blue sono state eseguite come descritto. 26

Per i test CFU-milza (CFU-S), topi femmina BALB/c (4-6 settimane) sono stati irradiati con una dose letale di irradiazione (900 cGy). Dopo 24 ore, i topi sono stati sottoposti a trapianto mediante iniezione nella vena della coda con 5 × 10 5 BM MNC ottenuti da topi wt trattati o non trattati con SB 290157 (5 μg/mL per 6 ore). Il giorno 12, le loro milze sono state rimosse e fissate nel fissativo Tellysyniczky e le colonie CFU-S sono state contate sulla superficie della milza usando una lente d'ingrandimento come descritto in precedenza. 9,22

Analisi del flusso di calcio

In breve, le cellule sono state incubate per 30 minuti a 30 ° C con Fura-2/AM (sonde molecolari) da 1 a 2 μM. Dopo l'incubazione, le cellule sono state lavate una volta, risospese in tampone di caricamento senza siero bovino di vitello (BCS), stimolate con SDF-1β (500 ng/mL) in presenza o assenza di 5 μg/mL SB 290157 e analizzate entro un'ora come precedentemente descritto. 9

Fosforilazione delle proteine ​​della via intracellulare

L'analisi Western blot è stata eseguita su estratti preparati da cellule CD34+ che erano state mantenute in un mezzo RPMI contenente bassi livelli di albumina sierica bovina (BSA, 0,5%) per rendere quiescenti le cellule. Le cellule sono state quindi stimolate con SDF-1 (300 ng/mL) o C3a (1 μg/mL) per 10 minuti a 37°C in presenza o assenza di SB 290157 (250 μM), prima di essere lisate per 10 minuti su ghiaccio in tampone di lisi M-Per (Pierce, Rockford, IL) contenente inibitori di proteasi e fosfatasi (Sigma Chemical). Le proteine ​​estratte sono state separate su gel di elettroforesi su gel di sodio dodecil solfato-poliacrilammide (SDS-PAGE) al 10% e trasferite su membrana di nitrocellulosa (Hybond electrochemiluminescence [ECL] Amersham Life Science, Little Chalfont, Regno Unito). La fosforilazione delle proteine ​​AKT e della proteina chinasi attivata da mitogeno 44/42 (MAPK) è stata rilevata mediante immunoblotting proteico utilizzando l'anticorpo monoclonale 44/42 MAPK fosfo-specifico di topo e gli anticorpi policlonali fosfo-specifici di coniglio (tutti da New England Biolabs, Beverly, MA ) per ciascuna delle proteine ​​rimanenti, con IgG anti-topo di capra coniugata con perossidasi di rafano o IgG anti-coniglio di capra (Santa Cruz Biotechnology, Santa Cruz, CA) come anticorpi secondari, come descritto. 26-29 L'uguale caricamento nelle corsie è stato valutato rimuovendo i blot e riprovandoli con gli opportuni anticorpi monoclonali o policlonali: anticorpo anti-p42/44 clone 9102 anti-MAPK e anticorpo anti-AKT clone 9272 (New England Biolabs). Le membrane sono state sviluppate con un reagente ECL (Amersham Life Science), essiccate ed esposte a pellicola (HyperFilm Amersham Life Science).

Mobilizzazione delle chimere di radiazioni

Animali normali (wt) o knock-out C3aR (KO) sono stati irradiati in modo letale (850 cGy) e 24 ore dopo sono stati sottoposti a trapianto attraverso il plesso retro-orbitale con MNC 5,5 × 10 6 BM da animali wt o KO. Gli animali sottoposti a trapianto sono stati lasciati recuperare per 5 settimane, dopo di che sono stati mobilizzati con G-CSF (250 μg/kg) per 3 giorni consecutivi. Il loro PB è stato valutato per il numero di CFU-GMs/100 μL circolanti come descritto. 5 Il chimerismo degli animali sottoposti a trapianto è stato confermato dalla PCR in tempo reale utilizzando il sistema di rilevamento delle sequenze ABI PRISM 7000 (Applied Biosystems, Foster City, CA). Il DNA è stato isolato da entrambe le MNC PB e BM utilizzando il mini kit QIAamp DNA (Qiagen, Valencia, CA). Il rilevamento specifico del DNA wt o KO è stato eseguito utilizzando primer specifici per l'esone 2 nel DNA wt (A201-5′-GAG AAT CAG GTG AGC CAA GGA GAA-3′) o per la cassetta Neo (NeoA-5′-TGG GCT CTA TGG CTT CTG AGG CGG AAA G-3′) nel DNA KO e un primer comune nella regione non codificante (C1-5′-TAC AAT ATA GTC AGT TGG AAG TCA GCC-3′). Il DNA totale è stato calcolato utilizzando tutti e 3 i primer. Le reazioni sono state normalizzate al DNA totale e i valori ΔCT sono stati convertiti in cambiamenti di piega usando l'equazione 2 –ΔCT. La differenza percentuale è stata calcolata in relazione alla quantità totale di DNA.

Analisi statistica

Le medie aritmetiche e le deviazioni standard sono state calcolate utilizzando il software Instat 1.14 (Graphpad, San Diego, CA). La significatività statistica è stata definita come P meno di .01. I dati sono stati analizzati utilizzando Student T test per campioni non appaiati.


Discussione

Il sistema immunitario innato è squisitamente pronto a rilevare e rispondere ai batteri che risiedono sulle superfici delle mucose (38, 39). Tuttavia, i patogeni cronici della mucosa hanno sviluppato molteplici strategie per sovvertire questo aspetto della risposta immunitaria (40). H. pylori ha coevoluto con il suo ospite umano affine per oltre 100.000 anni ed è adattato in modo univoco a sopravvivere per decenni all'interno del duro ambiente dello stomaco (41). Ciò ha reso necessario lo sviluppo di meccanismi per indurre l'infiammazione e strategie per eludere il rilevamento e sottoregolare la risposta immunitaria dell'ospite.

H. pylori ospita molteplici modelli mucosali associati ai patogeni che interagiscono in modo diverso con effettori immunitari innati rispetto alle rispettive controparti in altri patogeni mucosi acuti. Per esempio, H. pylori FlaA è una molecola non infiammatoria in termini di capacità di attivare TLR5 (42). H. pylori LPS contiene un nucleo lipidico anergico A che induce una risposta attenuata mediata da TLR4 (43, 44). Il caga T4SS rilascia peptidoglicano nelle cellule ospiti, dove è riconosciuto da NOD1 (7-11), e sebbene l'attivazione di NF-κB sia una risposta prototipica all'attivazione di NOD1, noi e altri abbiamo dimostrato che la preattivazione di NOD1 sopprime la successiva H. pylori–segnalazione NF-κB indotta tramite l'attivazione di un ciclo di feedback negativo e che consente la deacetilazione del peptidoglicano H. pylori per eludere l'autorizzazione dell'ospite (22, 45-47). Lavori più recenti hanno anche indicato che NOD1 può sopprimere l'infiammazione gastrica in risposta a H. pylori. Tran e colleghi. usato un modello murino di gastrite per dimostrare che H. pylori promuove l'attivazione di IL33, un mediatore delle risposte immunitarie Th2, tramite la segnalazione Nod1 (48). È importante sottolineare che H. pylori cag + ceppi attivano specificamente Nod1 nelle cellule epiteliali gastriche di topo, portando a livelli aumentati di IL33 nella mucosa gastrica e negli splenociti, che è stato collegato a risposte ridotte di IFNγ (48). I nostri risultati attuali sono coerenti con questi dati, come la perdita di Nod1 in due modelli indipendenti di H. pyloril'infiammazione e la lesione indotte aumentano il danno all'interno della nicchia gastrica. Tuttavia, ci sono percorsi aggiuntivi che possono regolare l'attivazione di NF-κB a seguito di H. pylori infezione che sono indipendenti da NOD1. Gallo e colleghi. hanno dimostrato che l'attivazione di NF-κB può essere indotta dalla proteina che interagisce con il fattore associato al recettore del TNF (TRAF) con il dominio associato al forkhead (TIFA), e che ciò avviene indipendentemente dall'attivazione di NF-κB mediata da NOD1 (49). Inoltre, l'attivazione di NF-κB segue H. pylori l'infezione avviene in modo temporalmente regolato, con l'induzione di TIFA che si verifica precocemente, che è successivamente seguita dall'attivazione di NF-kB NOD1-dipendente (49). L'attivazione selettiva di questi percorsi aggiuntivi in ​​diverse condizioni sperimentali può spiegare le differenze nei nostri risultati attuali rispetto ai risultati precedenti pubblicati da Viala e colleghi (7). Pertanto, gli studi futuri dovrebbero concentrarsi sulla valutazione delle vie di segnalazione immunitaria innata sia NOD1 che TIFA nei sistemi organoidi primari e modelli animali di infezione, utilizzando sia WT H. pylori cag + ceppi e ceppi mutanti con difetti caga sistemi di secrezione, per chiarire con precisione i contributi combinatori di questi costituenti a H. pylori patogenesi.

In questo studio, Nodo1 −/− genotipi non hanno alterato il fenotipo microbico di H. pylori derivate di output in termini di funzione T4SS. Però, Nod1-topi carenti hanno sviluppato un'infiammazione più grave rispetto ai topi WT quando colonizzati con H. pylori ceppi che ospitano un funzionale caga T4SS. Utilizzando un array di citochine multiplex per esaminare distinti effettori immunitari dell'ospite che possono contribuire a questo aumento dell'infiammazione, abbiamo osservato che, come previsto, H. pylori l'infezione ha ampiamente aumentato i livelli di citochine Th1, Th2 e Th17 e questi cambiamenti sono stati aumentati in presenza di deficit di Nod1. Tuttavia, le differenze stratificate sulla base del genotipo Nod1 sono diminuite nel tempo. Per analizzare ulteriormente questo aspetto, abbiamo utilizzato un innovativo sistema riduzionista in cui gli effetti di H. pylori su WT o Nodo1 −/− cellule epiteliali da sole o cellule epiteliali co-coltivate con macrofagi di varia natura Nod1 possibile accertare il genotipo. Abbiamo determinato che la perdita di Nod1 sia nelle cellule epiteliali che nei macrofagi aumenta la produzione di citochine proinfiammatorie in risposta a H. pylori infezione, sostenendo ulteriormente la premessa che NOD1 altera principalmente le risposte immunitarie innate a questo patogeno.Per definire più completamente i rispettivi contributi di ciascuno di questi costituenti cellulari, tuttavia, sarebbe necessario eliminare il macrofago e il componente delle cellule epiteliali gastriche della segnalazione Nod1-dipendente, sia individualmente che in combinazione. Questo potrebbe essere fatto attraversando Nod1-floxed topi e Foxa3-Cre topi (che dirige l'espressione di Cre ricombinasi ad epitelio gastrico rif. 50) in combinazione con l'esaurimento selettivo dei macrofagi utilizzando agenti come i liposomi di clodronato e i nostri risultati attuali hanno fornito un quadro importante per questi studi futuri.

Oltre alle differenze nei livelli di citochine tra Nod1 +/- e Nod1 −/−, abbiamo anche riscontrato differenze nei livelli di alcune citochine quando abbiamo confrontato C57BL/6 con topi INS-GAS FVB/N. Questi risultati probabilmente riflettono differenze nel background genetico dei topi in studio, nonché la presenza di ipergastrinemia, che è inerente ai topi INS-GAS portatori del transgene della gastrina umana (51). La gastrina esercita effetti simili a fattori di crescita sulle cellule epiteliali gastriche, che possono indurre la produzione di alcune chemochine e citochine (51). Inoltre, i topi INS-GAS hanno un background genetico FVB/N che in precedenza ha dimostrato di aumentare il rischio di carcinogenesi rispetto ai topi C57BL/6. In particolare, ciò può essere dovuto a un polimorfismo all'interno del Ptch1 gene, che codifica per un recettore inibitorio per i ligandi della famiglia di geni Hedgehog (52). Nel contesto dei nostri risultati, è stato notato che, tra l'altro, i livelli di espressione di IL9 erano downregolati in INS-GAS Nod1 −/− topi rispetto a C57BL/6 Nod1 −/− topi. IL9 è una citochina prodotta dalle cellule Th9, una sottopopolazione di cellule T CD4+, e diversi studi hanno dimostrato che IL9 sopprime la crescita tumorale (53, 54). Pertanto, livelli ridotti di IL9 in H. pylori–infetto INS-GAS Nod1 −/− i topi possono contribuire al fenotipo cancerogeno potenziato osservato in questi topi a seguito dell'infezione con questo patogeno.

Alterazioni nella composizione dei fenotipi funzionali dei macrofagi all'interno di una specifica nicchia infiammata possono alterare significativamente il rischio di carcinogenesi (55). I macrofagi M1 (attivati ​​classicamente) eliminano i patogeni attraverso l'attività microbicida intracellulare e secernono mediatori infiammatori che promuovono una risposta di tipo Th1, mentre contemporaneamente attenuano le risposte di tipo Th2 (55). I macrofagi M2 (attivati ​​alternativamente) promuovono la guarigione delle ferite secernendo componenti della matrice extracellulare e effettori antinfiammatori che promuovono le risposte dirette da Th2 attenuando le risposte Th1 (5). Anche i mreg (macrofagi regolatori) sono antinfiammatori, ma non riescono a depositare la matrice extracellulare (55). I nostri risultati utilizzando coculture epiteliali gastroide:macrofagi con o senza H. pylori ha rivelato che NOD1 probabilmente svolge un ruolo nella polarizzazione dei macrofagi poiché i macrofagi Nod1 WT co-coltivati ​​con cellule epiteliali hanno sviluppato un profondo fenotipo M1 in seguito all'esposizione a H. pylori rispetto a un fenotipo misto M1/M2 esibito da infetti Nodo1 −/− macrofagi. Un tale fenotipo ibrido può rendere i macrofagi carenti di Nod1 inefficaci nello smorzare le rispettive risposte dirette da Th1 o Th2, portando così a un modello più grave di infiammazione globale. I nostri risultati attuali forniscono un quadro importante per definire tali meccanismi nel lavoro futuro. Pertanto, la capacità di NOD1 di regolare i fenotipi dei macrofagi può anche contribuire alla capacità di H. pylori per eludere la clearance immunitaria dell'ospite.

In conclusione, questo studio dimostra che la perdita di NOD1 aumenta le risposte infiammatorie a H. pylori nell'ambito della cancerogenesi gastrica. NOD1 può esercitare il suo ruolo restrittivo alterando la polarizzazione dei macrofagi, portando così all'evasione immunitaria e alla persistenza microbica. Questi studi gettano le basi per un'ulteriore esplorazione del ruolo di NOD1-H. pylori interazioni negli ospiti umani e suggeriscono che la manipolazione di NOD1 può rappresentare una nuova strategia per prevenire o trattare gli esiti patologici indotti da H. pylori infezione.


Disponibilità di dati e materiali

Le sequenze Hi-C pubblicate per ESC e NPC sono state ottenute dal set di dati NCBI GEO GSE96107 [63]. Le sequenze ChIP-seq, RNA-seq e 4C-seq non processate generate in questo studio sono disponibili dal repository European Nucleotide Archive (EMBL-EBI ENA) con il numero di accesso PRJEB28762 [64]. I pattern di interazione 4C-seq elaborati sono disponibili nel repository dei dati di Mendeley [65]. I dati grezzi di microscopia sono disponibili dal repository Figshare [66].


Introduzione

L'adenosina è un metabolita immunosoppressivo critico, necessario per proteggere da una reazione immunitaria troppo zelante durante l'infiammazione e il danno tissutale (1). In risposta all'ipossia e allo stress extracellulare, l'adenosina viene generata dall'ATP dalle ectonucleotidasi CD39 e CD73 e segnala tramite quattro recettori dell'adenosina accoppiati a proteine ​​G (A1, A2A, A2B e A3 rivisti dal rif. 2). Il recettore dell'adenosina A2A ad alta affinità (A2AR) è altamente espresso sui linfociti e ha dimostrato di abrogare la loro attività. Nel microambiente tumorale (TME), la segnalazione dell'adenosina tramite l'A2AR impedisce un'efficace risposta immunitaria antitumorale inibendo l'infiltrazione e la funzione delle cellule CD8 + T e natural killer (NK) (3-6). Inoltre, è stato dimostrato che la segnalazione A2AR inibisce l'attivazione dei macrofagi (7) e influenza la proliferazione dei linfociti T, il priming e la produzione di citochine, portando alla polarizzazione a favore delle cellule T regolatorie immunosoppressive (8-10). All'omeostasi, i topi con deficit di A2AR mostrano una riduzione delle cellule CD44 lo CD4 + e CD8 + naive, suggerendo che la segnalazione dell'adenosina è fondamentale per il mantenimento delle cellule T (11). Tuttavia, la comprensione dell'impatto della segnalazione A2AR sulle cellule NK rimane limitata alla ridotta citotossicità e alla produzione di citochine in risposta all'adenosina esogena e agli analoghi dell'adenosina in vitro (4, 12, 13).

Le cellule linfoidi innate del gruppo 1 includono sia le cellule NK che le cellule linfoidi innate di tipo 1 (ILC1), le ultime delle quali sembrano essere più limitate a risiedere nei tessuti (14). Le cellule NK sono linfociti effettori innati fondamentali per il rapido riconoscimento di cellule trasformate o infette aberranti. La loro funzione dipende dall'impegno dei recettori attivatori o inibitori presenti sulla superficie cellulare, che determinano il rilascio di granuli citotossici e citochine pro-infiammatorie (14, 15). Sottoinsiemi di maturazione delle cellule NK funzionalmente distinti si distinguono per l'espressione di CD11b/CD27/KLRG1 e DNAM-1 nei topi (16-18) e CD56/CD16 nell'uomo (19). La carenza di una serie di vie tra cui la segnalazione di IL15 e i fattori di trascrizione EOMES, GATA-3, AIOLOS, ZEB2 e T-BET impedisce lo sviluppo di cellule NK mature (20-24). Tuttavia, i percorsi regolatori che guidano la maturazione delle cellule NK rimangono scarsamente definiti. Recentemente, l'accumulo di cellule NK funzionalmente mature è stato identificato in topi con cellule NK carenti di FOXO1 (25). A causa della loro capacità di generare una risposta immunitaria dell'ospite ad azione rapida e indipendente dall'antigene, le cellule NK vengono sempre più considerate per il loro potenziale terapeutico. L'identificazione di percorsi che migliorano l'accumulo di cellule NK funzionalmente mature è di grande interesse.

Qui, mostriamo che la carenza nella segnalazione A2AR migliora la maturazione delle cellule NK all'omeostasi, con cellule NK mature in fase terminale che mostrano una maggiore funzione e immunità antitumorale. Attualmente, gli antagonisti A2AR sono in fase di sperimentazione clinica per la loro sicurezza ed efficacia nei tumori solidi da soli o in combinazione con altre immunoterapie (NCT02655822 e NCT02403193). Sulla base dei nostri risultati, dovrebbe essere considerato l'uso di antagonisti A2AR come terapia adiuvante per potenziare l'efficacia dell'immunoterapia basata sulle cellule NK.


Metodi

Analisi dell'espressione dell'mRNA

Una matrice di tessuti multipli umani (MTE™) è stata acquistata dai laboratori Clonetech (Cat. #775-1). Contiene mRNA in quantità normalizzate per l'espressione di otto diversi geni domestici. La sonda di cDNA marcata con radioattivo P32 utilizzata per l'ibridazione conteneva una sequenza divergente di 4 kb che codifica per il dominio extracellulare della plexina ottenuta mediante restrizione EcoRI del costrutto umano a lunghezza intera. L'ibridazione è stata eseguita utilizzando la soluzione Ultrahybe ® (Ambion Austin, TX, US) secondo il protocollo fornito dal produttore.

L'espressione della plexina nelle cellule endoteliali della vena ombelicale umana (Cambrex) è stata rilevata mediante RT-PCR utilizzando coppie di primer gene-specifici fornite da Applied Biosystem (Hs00182227_m1 per PlexinB1 e Hs00367063_m1 per PlexinB2).


Le cellule T endogene prevengono la fuga immunitaria del tumore dopo la terapia con cellule T adottive

McMaster Immunology Research Centre, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Hamilton, Ontario, Canada.

Indirizzo della corrispondenza a: Yonghong Wan, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Room MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Canada, L8N 3Z5. Telefono: 905.525.9140 int. 22461 E-mail: [email protected]

McMaster Immunology Research Centre, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Hamilton, Ontario, Canada.

Indirizzare la corrispondenza a: Yonghong Wan, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Room MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Canada, L8N 3Z5. Telefono: 905.525.9140 int. 22461 E-mail: [email protected]

Trova articoli di Simovic, B. in: JCI | PubMed | Google Scholar

McMaster Immunology Research Centre, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Hamilton, Ontario, Canada.

Indirizzare la corrispondenza a: Yonghong Wan, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Room MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Canada, L8N 3Z5. Telefono: 905.525.9140 int. 22461 E-mail: [email protected]

McMaster Immunology Research Centre, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Hamilton, Ontario, Canada.

Indirizzare la corrispondenza a: Yonghong Wan, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Room MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Canada, L8N 3Z5. Telefono: 905.525.9140 int. 22461 E-mail: [email protected]

McMaster Immunology Research Centre, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Hamilton, Ontario, Canada.

Indirizzare la corrispondenza a: Yonghong Wan, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Room MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Canada, L8N 3Z5. Telefono: 905.525.9140 int. 22461 E-mail: [email protected]

McMaster Immunology Research Centre, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Hamilton, Ontario, Canada.

Indirizzo della corrispondenza a: Yonghong Wan, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Room MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Canada, L8N 3Z5. Telefono: 905.525.9140 int. 22461 E-mail: [email protected]

Trova articoli di Stephenson, K. in: JCI | PubMed | Google Scholar

McMaster Immunology Research Centre, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Hamilton, Ontario, Canada.

Indirizzo della corrispondenza a: Yonghong Wan, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Room MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Canada, L8N 3Z5. Telefono: 905.525.9140 int. 22461 E-mail: [email protected]

McMaster Immunology Research Centre, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Hamilton, Ontario, Canada.

Indirizzo della corrispondenza a: Yonghong Wan, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Room MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Canada, L8N 3Z5. Telefono: 905.525.9140 int. 22461 E-mail: [email protected]

Trova articoli di Bramson, J. in: JCI | PubMed | Google Scholar

McMaster Immunology Research Centre, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Hamilton, Ontario, Canada.

Indirizzo della corrispondenza a: Yonghong Wan, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Room MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Canada, L8N 3Z5. Telefono: 905.525.9140 int. 22461 E-mail: [email protected]

McMaster Immunology Research Centre, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Hamilton, Ontario, Canada.

Indirizzare la corrispondenza a: Yonghong Wan, Dipartimento di Patologia e Medicina Molecolare, McMaster University, Room MDCL-5024, 1200 Main Street West, Hamilton, Ontario, Canada, L8N 3Z5. Telefono: 905.525.9140 int. 22461 E-mail: [email protected]

Pubblicato il 4 novembre 2019 - Maggiori informazioni

Mentre l'esito della terapia cellulare T adottiva (ACT) è tipicamente correlato con la funzionalità delle cellule T inoculate, il ruolo delle cellule T endogene è sconosciuto. Il successo della terapia con blocco del checkpoint ha dimostrato il valore potenzialmente curativo delle cellule T preesistenti innescate dal tumore nel trattamento del cancro. Dati i risultati della terapia con blocco del checkpoint, abbiamo ipotizzato che le cellule T endogene contribuiscano alla sopravvivenza a lungo termine dopo l'ACT. Qui, descriviamo un approccio terapeutico che combina ACT con un vaccino oncolitico che consente l'analisi simultanea dell'immunità antitumorale mediata da cellule T trasferite ed endogene. Abbiamo scoperto che, oltre a promuovere l'espansione e l'infiltrazione tumorale delle cellule T trasferite, i vaccini oncolitici hanno potenziato le cellule T dell'ospite innescate dal tumore. Abbiamo determinato che le cellule T trasferite hanno contribuito alla rapida distruzione di grandi masse tumorali mentre le cellule T endogene hanno impedito contemporaneamente l'emergere di varianti con perdita di antigene. Inoltre, mentre le cellule T trasferite sono scomparse poco dopo la regressione del tumore, le cellule T endogene hanno assicurato la memoria a lungo termine con un ampio repertorio di specificità dell'antigene. I nostri risultati suggeriscono che questa strategia di combinazione può sfruttare il pieno potenziale dell'ACT e delle cellule T dell'ospite innescate dal tumore per eliminare il tumore primario, prevenire la fuga immunitaria e fornire memoria protettiva a lungo termine.

L'accumulo di prove correlative suggerisce che le cellule T dell'ospite possono essere attivate spontaneamente in risposta al tumore in crescita attraverso il riconoscimento degli antigeni tumorali. In particolare, i tumori che ospitano un gran numero di mutazioni hanno maggiori probabilità di attivare le cellule T endogene a causa dell'immunogenicità dei neoantigeni che sono riconosciuti come estranei dal sistema immunitario, fornendo così bersagli per l'attacco delle cellule T (1). La rilevanza clinica di questi risultati è stata sottolineata dalla correlazione tra il carico di mutazione e l'esito del trattamento con il blocco del checkpoint immunitario che si basa sulla presenza di popolazioni di cellule T innescate dal tumore ( 2 – 5). Tuttavia, le risposte spontanee delle cellule T contro gli antigeni mutanti sono relativamente inefficienti e nella maggior parte dei casi non riescono a mediare il rigetto del tumore. In effetti, il fatto che solo un sottogruppo di pazienti mostri risposte durature al blocco del checkpoint immunitario suggerisce che non tutti i pazienti hanno cellule T innescate dal tumore che sono sufficienti per sradicare i tumori una volta scatenati.

La terapia con cellule T adottive (ACT) con cellule T antigene-specifiche rappresenta un'eccellente alternativa alle terapie con inibitori del checkpoint per il trattamento di tumori maligni (6). Cellule T tumore-specifiche sane possono essere coltivate in vitro e infuse in gran numero in pazienti con malattia avanzata, superando così l'insufficienza delle risposte spontanee delle cellule T nei pazienti oncologici. È importante sottolineare che sono state sviluppate metodologie cliniche per propagare cellule T funzionali specifiche del tumore in vitro ( 7 – 9 ), e recenti successi clinici nella leucemia, melanoma, neuroblastoma e neoplasie associate all'EBV hanno dimostrato che l'ACT è una strategia praticabile ed efficace nel umani (10 – 14). Tuttavia, un passaggio necessario per il successo dell'ACT è la linfodeplezione dell'ospite prima di infondere le cellule T, un processo chiamato precondizionamento, che è altamente tossico per alcuni pazienti (15-17). Inoltre, sebbene il precondizionamento possa creare un ambiente favorevole per le cellule T trasferite adottivamente (cioè l'eliminazione delle cellule T regolatorie e dei "pozzi" di citochine omeostatiche), rimuove anche le cellule T preesistenti innescate dal tumore, rendendo difficile, se non impossibile, determinare il ruolo e il beneficio dell'immunità antitumorale endogena nel contesto dell'ACT.

Abbiamo precedentemente riportato che i virus oncolitici (OV) progettati per esprimere antigeni associati al tumore possono efficacemente coinvolgere ed espandere le cellule T di memoria specifiche del tumore mantenendo la loro capacità intrinseca di infettare e debulk direttamente il tumore e invertire il microambiente tumorale immunosoppressivo (18, 19). ). In questo studio, abbiamo studiato l'uso di vaccini oncolitici basati su rabdovirus e vaccinia virus (basati su VacV) per guidare l'espansione sistemica e l'infiltrazione tumorale delle cellule T trasferite adottivamente, migliorando così l'efficacia terapeutica dell'ACT. Questa combinazione razionale ha portato a una regressione tumorale completa e duratura in assenza di precondizionamento, un probabile risultato di citochine proinfiammatorie indotte dal virus che forniscono supporto per le risposte delle cellule T antitumorali (20). Utilizzando questo modello, abbiamo monitorato contemporaneamente il contributo delle cellule T trasferite ed endogene all'effetto terapeutico. I nostri dati indicano che le cellule T dell'ospite preesistenti, innescate dal tumore, sono fondamentali per prevenire e/o eliminare le varianti di fuga dell'antigene per ottenere una regressione duratura mediante ACT e per la memoria immunitaria a lungo termine.

La combinazione di ACT con vaccini oncolitici induce la completa regressione del tumore e l'immunità protettiva a lungo termine. Motivati ​​dalla capacità unica dei vaccini rabdovirali OV (OVV) di innescare simultaneamente un'efficace espansione delle cellule T di memoria centrale (Tcm) preesistenti nella periferia e un rapido reclutamento nel tumore (18, 19, 21), abbiamo esplorato la combinazione di ACT utilizzando Tcm antigene tumorale differenziato in vitro specifico con vaccini contro il virus della stomatite vescicolare oncolitica (VSV) per il trattamento di tumori solidi stabiliti. I topi WT BALB/c sono stati stimolati per via intradermica (i.d.) con cellule CMS5, un fibrosarcoma indotto da metilcolantrene che esprime un neoepitopo definito derivato da una mutazione nel gene ERK2 (ErkM136–144, QYIHSANVL) ( 22 ). ErkM136–144-cellule CD8 + T specifiche da topi transgenici DUC18 ( 23 ) sono state coltivate ed espanse in presenza di IL-15, IL-21 e rapamicina, che ha guidato l'acquisizione di un tipico fenotipo Tcm (CD62L + CD44 +) (Figura supplementare 1A materiale supplementare disponibile online con questo articolo https://doi.org/10.1172/JCI126199DS1). Dopo 6 giorni di crescita del tumore, i topi sono stati trattati con i.v. iniezione di 10 6 DUC18 Tcm, 10 8 PFU di VSV-ErkM o una combinazione di DUC18 Tcm seguita 24 ore dopo da VSV-ErkM. Abbiamo scelto di testare i.v. somministrazione esclusivamente di VSV, come abbiamo precedentemente dimostrato che questa è una via ottimale per ottenere sia la presentazione dell'antigene nella periferia per aumentare il Tcm sia l'infezione del tumore per l'oncolisi e il reclutamento di cellule T da parte di un vaccino VSV (18, 19).In effetti, l'iniezione intratumorale di VSV non è riuscita a potenziare costantemente le cellule T trasferite a un livello efficace e a causare la regressione del tumore (dati non mostrati). La Figura 1A mostra che né il solo Tcm né il solo vaccino VSV hanno avuto un impatto significativo sulla crescita del tumore, mentre la combinazione di Tcm e vaccino potenziatore di VSV ha indotto una regressione completa del tumore e una sopravvivenza significativamente prolungata (Figura 1B). Tuttavia, le cellule T effettrici DUC18 (Teff) (differenziate in presenza di IL-2 supplementare Figura 1A), da sole o in combinazione con VSV-ErkM, non sono riuscite a indurre una regressione tumorale completa e sostenuta in tutti i topi trattati (Figura 1C) , un risultato correlato alla scarsa persistenza delle cellule trasferite (dati non mostrati). Sebbene la vaccinazione VSV sia stata in grado di prolungare significativamente la sopravvivenza dopo il trasferimento di Teff, la regressione indotta da Tcm più VSV-ErkM è stata più coerente e la successiva sopravvivenza è stata significativamente prolungata rispetto ai trattamenti a base di Teff (Figura 1D), coerentemente con il nostro lavoro precedente e l'attuale comprensione ( 19, 24).

La combinazione di Tcm e VSV-ErkM porta a una regressione del tumore durevole. I topi BALB/c sono stati inoculati i.d. con cellule CMS5 7 giorni prima del trasferimento adottivo di DUC18 Tcm (10 6 cellule/topo) e, dove indicato, sono state trattate con il vaccino/virus specificato 24 ore dopo. I topi che ricevevano solo VSV-ErkM, solo Tcm o PBS sono stati inclusi come controlli. (UN, C, e E) Volumi tumorali e (B, D, e F) la sopravvivenza dei topi CMS5 TB BALB/c è stata monitorata al dpt specificato con 0 dpt che rappresentano il giorno dell'inoculazione del vaccino e sono espressi come mm 3 . Un volume del tumore di 1000 mm 3 è stato utilizzato come punto finale per l'analisi di sopravvivenza. (G) I topi sopravvissuti alla sfida iniziale del tumore CMS5 dopo il trattamento con Tcm più VSV-ErkM sono stati ritrattati con cellule CMS5 60 giorni dopo e viene mostrata la successiva sopravvivenza. Un gruppo di topi ingenui sfidati con cellule CMS5 è stato incluso come controllo. I dati sono mostrati come risultati rappresentativi di 4 (UN e B), 3 (CF), o 2 (F) esperimenti indipendenti con n = 5 per gruppo. I dati sono stati analizzati utilizzando un test log-rank (Mantel-Cox) (B, D, F e G). *P < 0,05 **P < 0.01.

Per determinare ulteriormente se il solo vaccino Tcm più OV (senza un antigene tumorale definito) o convenzionale (senza attività oncolitica o di targeting tumorale) è sufficiente per ottenere un'efficacia simile a quella del vaccino Tcm più oncolitico, abbiamo testato gruppi aggiuntivi, incluso VSV- MT (mancante del transgene ErkM), un vettore adenovirale carente di replicazione che esprime ErkM (Ad-ErkM), e il peptide ErkM adiuvato con l'anticorpo poli I:C/CD40 (25). Come mostrato nella Figura 1, E e F, Tcm più VSV-MT non è riuscito a controllare la crescita del tumore o a prolungare la sopravvivenza, confermando che è necessaria la vaccinazione OV antigene-specifica per espandere le cellule T trasferite e reclutarle nel tumore. Coerentemente con questa nozione, il potenziamento con vaccini non oncolitici era meno efficace del vaccino VSV, con il quale solo una piccola frazione di topi trattati mostrava una completa regressione del tumore e una sopravvivenza prolungata (Figura 1, E e F).

Per visualizzare direttamente l'infiltrazione tumorale delle cellule T CD8 + e la loro localizzazione nel tumore, abbiamo colorato i tessuti tumorali il giorno 5 dopo la vaccinazione ACT o ACT più. Come mostrato nella Figura 2, la distribuzione peritumorale delle cellule T CD8 + era evidente dopo il solo trasferimento di Tcm e la vaccinazione con Tcm più, ma è stato osservato un numero significativamente maggiore di cellule T CD8 + (Figura supplementare 2) che penetravano in profondità nel tessuto tumorale dopo VSV potenziamento, confermando che gli OVV offrono vantaggi distinti rispetto ai vaccini convenzionali nel contesto dell'ACT. Infine, il 100% dei sopravvissuti a lungo termine (60+ giorni) dopo il trattamento con Tcm più VSV-ErkM ha rifiutato un rechallenge con cellule CMS5 2 mesi dopo l'interruzione della terapia e ha mostrato una sopravvivenza significativamente prolungata, suggerendo la formazione di una memoria immunologica efficace (Figura 1G).

Il trattamento con OVV guida l'infiltrazione del nucleo tumorale delle cellule CD8 + T trasferite. Le micrografie dei tessuti tumorali CMS5 colorati con un anticorpo anti-CD8 mostrano una relativa infiltrazione del nucleo e della periferia del tumore con cellule T indotte dai trattamenti indicati. Le immagini a basso ingrandimento dell'intero tumore sono mostrate nei pannelli di sinistra e le immagini a più alto ingrandimento della periferia del tumore (delineate da riquadri neri) e del nucleo del tumore (delineato da riquadri blu) sono mostrate nei riquadri centrale e di destra. Barre di scala: 500 μm (pannelli a sinistra) 200 μm (pannelli al centro e a destra).

L'espansione e la persistenza delle cellule CD8 + T endogene ErkM-reattive sono determinate dal tumore durante la terapia di combinazione. Per comprendere ulteriormente come il vaccino VSV influenzi il destino delle cellule T trasferite, abbiamo anche monitorato le risposte delle cellule T nella periferia. ErkM136–144-l'espansione specifica delle cellule CD8 + T nella circolazione potrebbe essere rilevata già 2 giorni dopo la vaccinazione VSV, che ha raggiunto il picco al giorno 5 e successivamente è diminuita (Figura 3A), in coincidenza con la cinetica della regressione del tumore CMS5 (Figura supplementare 1B). Sebbene le risposte delle cellule T antigene-specifiche siano diminuite dopo il picco, sono rimaste a circa il 10% delle cellule CD8 + T circolanti per più di 2 mesi (Figura 3A). È interessante notare che ulteriori analisi utilizzando marcatori congenici hanno indicato che l'espansione di ErkM136–144-cellule T specifiche erano dominate da cellule DUC18 trasferite adottivamente (Thy1.1 +) a 5 giorni dopo il trattamento (dpt), ma sono state sostituite da cellule T CD8 + endogene (Thy1.2 +) da 12 dpt in poi (Figura 3B). Per determinare se la perdita delle cellule DUC18 trasferite dalla circolazione fosse dovuta a una localizzazione differenziale, abbiamo analizzato sangue, milza e midollo osseo il giorno 60 dopo il trattamento. La maggioranza di ErkM136–144Le cellule T specifiche erano cellule CD8 + T endogene in tutti e 3 i compartimenti, confermando che le cellule DUC18 trasferite sono effettivamente scomparse dopo la regressione del tumore (Figura 3C). Questa osservazione ci ha spinto a valutare ErkM136–144– risposte specifiche delle cellule T guidate da VSV-ErkM in animali naive privi di tumore (TF) rispetto a topi portatori di tumore (TB). I topi WT BALB/c hanno ricevuto 10 6 DUC18 Tcm 1 giorno prima della vaccinazione con 10 8 PFU di VSV-ErkM e le risposte delle cellule T specifiche per ErkM sono state monitorate nei giorni 5, 12 e 19 dopo il trattamento con VSV. La Figura 3D mostra che la cinetica dell'espansione delle cellule T nei topi TF era simile a quella degli animali con tubercolosi, sebbene la velocità di contrazione fosse significativamente più lenta a 12 dpt. Ancora più importante, una percentuale significativamente più alta di ErkM . rilevata136–144-Le cellule T specifiche erano di origine DUC18 (Thy1.1 +) in tutti i momenti nei topi TF rispetto ai topi TB (Figura 3E), suggerendo che (a) DUC18 non hanno difetti intrinseci cellulari nella sopravvivenza e (b) le loro morti sono probabilmente il risultato di interazioni con le cellule tumorali. Quest'ultima speculazione è stata supportata dal fatto che oltre il 90% delle cellule T CD8 + nel tumore erano Thy1.1 + il giorno 4 dopo il potenziamento di VSV (Figura 3F), ma successivamente hanno subito un'apoptosi progressiva (dal 32% al giorno 4 al 95% il giorno 6) in coincidenza con il momento della regressione del tumore. Al contrario, l'espansione delle cellule T endogene specifiche di ErkM non ha raggiunto il picco fino a 12 dpt (Figura 3B), suggerendo che un numero sostanziale di cellule T endogene non ha interagito direttamente con il tumore e quindi è rimasto nel pool di memoria.

L'espansione e la persistenza delle cellule CD8 + T reattive all'ErkM sono influenzate dal tumore durante la terapia di combinazione. (UN) Il sangue venoso è stato raccolto nel reparto designato. Sono state valutate la componente virale della terapia di combinazione e la frequenza delle risposte delle cellule CD8 + T specifiche per ErkM. (B) La proporzione di cellule trasferite adottivamente rispetto a cellule endogene all'interno del pool totale di cellule CD8 + T specifiche per ErkM in circolazione è stata determinata da anticorpi specifici per Thy1.1 (trasferito) e Thy1.2 (endogeno) in cellule IFN-γ + gated al punti temporali indicati. (C) Le cellule T CD8 + raccolte da sangue, milza e midollo osseo di topi 60 giorni dopo la regressione del tumore CMS5 indotta dalla terapia di combinazione sono state valutate per la specificità di ErkM. I punti neri rappresentano la frequenza totale delle cellule CD8 + T specifiche per ErkM e le caselle grigie sovrapposte rappresentano la frequenza delle cellule CD8 + T specifiche per ErkM trasferite. (D) Entità delle risposte delle cellule CD8 + T specifiche di ErkM e (E) frequenza delle cellule Thy1.1 + T nel pool totale di cellule CD8 + T specifiche per ErkM nella circolazione di topi TB e TF come valutato nei punti temporali indicati. (F) Vengono mostrati i profili rappresentativi di citometria a flusso di cellule CD8 + T infiltranti il ​​tumore co-contenute per Thy1.1 e annessina V nei giorni 4 e 6 dopo la vaccinazione. I dati sono rappresentativi dei risultati di 3 (UN e B) o 2 (CF) esperimenti indipendenti con n = 5 per gruppo. I dati sono stati analizzati utilizzando ANOVA a 1 via (UN), a 2 code T test (C), o ANOVA a 2 vie con misure ripetute con correzione di Holm-Šidák per confronti multipli (B, D, e E). *P < 0,05 ***P < 0,001 ****P < 0,0001.

La terapia di combinazione induce la perdita dell'antigene in assenza di linfociti endogeni. L'osservazione dell'effettiva espansione e della persistenza a lungo termine delle cellule CD8 + T endogene ErkM-reattive negli animali CMS5 TB ci ha spinto a valutare il ruolo dei linfociti dell'ospite nella regressione del tumore indotta dalla terapia di combinazione. I topi NRG, privi di linfociti maturi, erano i.d. inoculato con 10 6 cellule CMS5 6 giorni prima della terapia di combinazione con 10 6 DUC18 Tcm più 10 8 PFU di VSV-ErkM. La Figura 4, A e B, mostra che è stata ottenuta una regressione completa del tumore nei topi NRG e, sebbene la sopravvivenza sia stata significativamente prolungata nel gruppo trattato con Tcm più VSV-ErkM, i tumori in tutti i topi alla fine hanno avuto una recidiva. Simile all'osservazione nei topi WT, le cellule T trasferite sono diventate non rilevabili nella circolazione in seguito alla regressione del tumore, ma un numero significativamente più alto di cellule Thy1.1 + persisteva nei topi TF NRG (Figura 4C), confermando che il destino delle cellule T trasferite è influenzati dalle loro interazioni con il tumore. Abbiamo ipotizzato che le cellule tumorali CMS5 recidivate potrebbero non esprimere più l'epitopo ErkM e quindi sfuggire all'eliminazione mediata da DUC18. Per verificare questa possibilità, abbiamo eseguito altri 2 esperimenti. In primo luogo, abbiamo stabilito tumori nei topi WT BALB/c utilizzando cellule CMS5 parentali o CMS5 recidivate recuperate da topi NRG trattati in combinazione (CMS5r), seguite dal trattamento con DUC18 Tcm più VSV-ErkM. La Figura 4D mostra che la regressione duratura è stata ricapitolata nei topi portatori di cellule CMS5 parentali, ma lo stesso trattamento non è riuscito a sradicare le cellule CMS5r, con conseguente sopravvivenza significativamente ridotta (Figura 4E), confermando che le cellule CMS5r non possono essere riconosciute dalle cellule CD8 + T specifiche di ErkM . In secondo luogo, l'analisi PCR del DNA genomico da CMS5, CMS5r e CT26 (una linea cellulare di controllo irrilevante) ha indicato che le cellule CMS5 recidivate avevano effettivamente subito una perdita di eterozigosi nel gene ERK2, con conseguente eliminazione dell'allele ERK2 mutante e quindi perdita dell'antigene ErkM (Figura 4, F–H). Infine, come previsto, le cellule CMS5r erano resistenti all'uccisione da parte delle cellule DUC18 Teff in vitro mentre l'espressione ingegnerizzata del peptide ErkM in queste cellule le rendeva suscettibili all'uccisione, analogamente alle cellule CMS5, confermando che la resistenza di CMS5r alle cellule T specifiche di ErkM la lisi era dovuta all'assenza dell'espressione dell'antigene bersaglio, ma non ad altre alterazioni (Figura 3 supplementare). Questi risultati evidenziano un ruolo importante dei linfociti endogeni nell'evitare la selezione immunitaria delle varianti di perdita dell'antigene durante l'ACT.

I linfociti endogeni prevengono la crescita di cellule tumorali antigene-negative. I topi NRG sono stati inoculati i.d. con cellule CMS5 7 giorni prima del trasferimento adottivo di DUC18 Tcm (10 6 cellule/topo). Un giorno dopo il trasferimento di Tcm, i topi sono stati vaccinati i.v. con VSV-ErkM (2 × 10 8 PFU/mouse). I topi che ricevevano solo VSV-ErkM, solo Tcm o PBS sono stati inclusi come controlli. (UN) Volume del tumore e (B) la sopravvivenza dei topi trattati è mostrata al dpt indicato. (C) I numeri di cellule T CD8 + trasferite (Thy1.1 + ) nel sangue periferico di topi TB e TF NRG nei giorni 3, 5, 12 e 19 dopo la terapia di combinazione sono stati determinati mediante analisi di flusso. I topi WT sopravvissuti alla provocazione del tumore CMS5 iniziale dopo il trattamento con Tcm più VSV-ErkM sono stati ritrattati con cellule di recidiva CMS5 (CMS5r) 60 giorni dopo e successiva crescita del tumore (D) e sopravvivenza (E) sono mostrati. I topi ingenui che hanno ricevuto CMS5 sono stati inclusi come controlli. I dati sono mostrati come risultati rappresentativi di 3 (UN e B) o 2 (CE) esperimenti indipendenti con n = 5 per gruppo. I dati sono stati analizzati utilizzando ANOVA a 2 vie a misure ripetute con correzione Holm-Šidák per confronti multipli (C) e log-rank test (Mantel-Cox) (B e E). *P < 0,05 **P < 0.01. (F) Lo schema del prodotto della PCR risultante dall'amplificazione del DNA genomico del gene ERK2 è mostrato con il simbolo SfcI sequenza di riconoscimento generata dalla mutazione ErkM visualizzata in lettere maiuscole. Frammenti previsti generati da SfcI digestione degli ampliconi PCR da WT ERK (bande 356 bp per ErKwt) e alleli ERK mutanti (bande 260 e 96 bp per ErKM) sono mostrati con parentesi tratteggiate. (G) Viene mostrata la digestione con restrizione dei prodotti della PCR amplificati dal DNA genomico della linea cellulare CT26 (controllo negativo), CMS5 e CMS5r e (h) cromatogramma del risultato del sequenziamento dai prodotti della PCR.

Sia le cellule CD4+ che quelle CD8+ endogene sono necessarie per prevenire la fuga del tumore durante la terapia di combinazione. Per determinare il sottoinsieme di linfociti endogeni necessari per prevenire le recidive durante la terapia di combinazione, abbiamo eseguito esperimenti di deplezione anticorpale in vivo in topi TB trattati con DUC18 Tcm più VSV-ErkM. Gli anticorpi contro CD4 o Thy1.2 sono stati somministrati 1 giorno prima dell'inoculazione del tumore, mentre l'anticorpo anti-CD8 è stato somministrato 1 settimana prima per evitare il suo effetto sulle cellule T DUC18 trasferite. Tutti i topi trattati hanno avuto una regressione del tumore indipendentemente dall'esaurimento selettivo dei linfociti endogeni (Figura 5A), che è simile alle osservazioni nei topi NRG trattati (Figura 4A) che sono geneticamente carenti per i linfociti endogeni. Tuttavia, la ricaduta si è verificata nell'80% dei topi che hanno ricevuto l'anticorpo CD8 e nel 100% in caso di deplezione di CD4 o Thy1.2 (Figura 5A), confermando che sia le cellule CD4 + che CD8 + endogene sono necessarie per prevenire la recidiva del tumore dopo il trattamento con ACT più vaccinazione oncolitica. Abbiamo anche incluso un gruppo che ha ricevuto ciclofosfamide (CPX), un farmaco chemio comunemente usato per la linfodeplezione (26, 27), 1 giorno prima della terapia di combinazione. Analogamente a quanto avvenuto con il trattamento con anticorpi, la CPX non ha influito sulla regressione iniziale del tumore, ma tutti gli animali hanno avuto una recidiva entro 2 settimane (Figura 5A). Tutti i trattamenti di deplezione anticorpale e CPX hanno determinato una significativa diminuzione della sopravvivenza (Figura 5B)

Sia le cellule CD4+ che quelle CD8+ endogene sono necessarie per prevenire la fuga del tumore durante la terapia di combinazione. I topi CMS5 TB BALB/c sono stati impoveriti di specifiche popolazioni di linfociti tramite il trattamento con l'anticorpo indicato o CPX in concomitanza con il trattamento con la terapia di combinazione e la conseguente crescita del tumore (UN) e sopravvivenza (B) sono stati monitorati. Gli anticorpi sono stati somministrati 1 giorno prima e 1 giorno dopo il trasferimento delle cellule T e successivamente una volta alla settimana per 3 settimane. Una singola iniezione di CPX è stata somministrata 1 giorno prima del trasferimento delle cellule T. (C) La frequenza delle risposte delle cellule CD8 + T che diffondono l'antigene nel sangue periferico è stata quantificata tramite stimolazione con un pool di 4 peptidi corrispondenti a neoepitopi CMS5 precedentemente identificati (27) e colorazione per la produzione di IFN-γ. (D) La frequenza delle cellule T specifiche per ErkM nel sangue periferico di topi BALB/c sopravvissuti alla provocazione del tumore CMS5 iniziale dopo la terapia di combinazione (60+ giorni) è stata valutata prima e 5 giorni dopo il rechallenge con cellule CMS5 o recidiva CM5 (CMS5r), e risultante sopravvivenza (E) è anche mostrato. I topi ingenui che hanno ricevuto il challenge CMS5 o CMS5r sono stati inclusi come controlli. (F) Sopravvivenza di topi vaccinati con cellule CMS5r irradiate in modo letale (irrCMS5r) prima del challenge con cellule CMS5 o CMS5r. (G) Sopravvivenza di topi con regressione del tumore (come descritto sopra) ritrattati con CMS5r dopo deplezione di popolazioni di linfociti con gli anticorpi indicati. I dati sono mostrati come rappresentativi di 2 esperimenti indipendenti (UNE e G) o un singolo esperimento (F) insieme a n = 5 per gruppo. I dati sono stati analizzati utilizzando ANOVA a 1 via con correzione Holm-Šidák per confronti multipli (C), accoppiato a 2 code T test (D), e log-rank test (Mantel-Cox) (B e EG). *P < 0,05 **P < 0,01 ***P < 0.001.

Un possibile meccanismo per il fabbisogno di linfociti T endogeni è dovuto alla diffusione degli epitopi, conseguenza della distruzione del tumore mediante terapia di combinazione, che si traduce in una seconda ondata di attacco antitumorale contro antigeni diversi. Questa nozione sembrava essere supportata dal fatto che la regressione iniziale del tumore dopo la terapia di combinazione non richiedeva linfociti endogeni (Figure 4A e 5A). Abbiamo quindi ipotizzato che la deplezione in vivo delle cellule T CD4 + e/o CD8 + il giorno 6 dopo ACT più la vaccinazione oncolitica (un momento in cui i tumori stavano ancora regredendo) avrebbe portato a una recidiva. Sorprendentemente, tuttavia, l'esaurimento di uno o di entrambi i sottogruppi non ha portato alla recidiva del tumore (dati non mostrati), suggerendo che le cellule T endogene reattive al tumore devono essere presenti prima o essere indotte estremamente rapidamente dalla terapia di combinazione, che è fondamentale per la completa eradicazione delle cellule tumorali in collaborazione con cellule T trasferite adottivamente. L'evidenza che l'espansione delle cellule CD8 + T endogene specifiche per ErkM è stata osservata già 2 giorni dopo il potenziamento di VSV (Figura 3A) favorisce la possibilità di cellule T endogene preesistenti innescate dal tumore che possono essere scatenate o addirittura potenziate dalla terapia combinata per partecipare all'inizio eliminazione del tumore.

Abbiamo fatto un tentativo di determinare se le risposte delle cellule CD8 + T contro antigeni non mirati potessero essere rilevate nella circolazione. Le cellule mononucleate sono state raccolte dal sangue 5 giorni dopo l'ACT con o senza potenziamento del vaccino. La produzione di IFN-γ da parte delle cellule CD8 + T è stata quantificata 4 ore dopo la stimolazione con un pool di peptidi costituito da 4 neoepitopi immunogenici identificati da Duan et al. (28). Come mostrato nella Figura 5C, sebbene il livello di risposte delle cellule CD8 + T contro i peptidi neoepitopici in pool fosse trascurabile nei topi che hanno ricevuto solo ACT, potrebbe essere notevolmente potenziato dalla vaccinazione con un vaccino oncolitico. Questo risultato, insieme ai dati mostrati nella Figura 2A, ha confermato che erano presenti cellule T endogene innescate dal tumore specifiche per antigeni mirati e non mirati e potevano essere rapidamente amplificate dalla vaccinazione oncolitica.

Le cellule T endogene formano un'immunità antitumorale a lungo termine negli animali dopo la terapia di combinazione. Per determinare la persistenza e la funzione protettiva delle cellule T endogene, in particolare quelle che riconoscono antigeni tumorali non mirati, abbiamo deciso di ritrattare i sopravvissuti (TF per >60 giorni dopo l'eliminazione dei tumori CMS5 iniziali) con un i.d. iniezione di cellule CMS5r.Abbiamo anche incluso un gruppo sottoposto a rechallenge con cellule CMS5 parentali come controllo analitico. Cinque giorni dopo il rechallenge, abbiamo stimolato i PBMC campionati con il peptide ErkM e confrontato la frequenza delle cellule IFN-γ + CD8 + T con quella negli stessi animali prima del rechallenge. Come previsto, è stato osservato un aumento di circa 3 volte delle cellule T CD8 + ErkM-reattive nei sopravvissuti a cui è stato somministrato CMS5, mentre il rechallenge con CMS5r non ha potenziato alcuna risposta delle cellule CD8 + T specifiche di ErkM, rafforzando il fatto che CMS5r ha perso l'espressione di ErkM (Figura 5D). È interessante notare, tuttavia, che nessuna delle linee cellulari è stata in grado di formare tumori nei sopravvissuti, sebbene entrambe siano cresciute rapidamente nei topi non trattati e abbiano ridotto significativamente la sopravvivenza (Figura 5E), suggerendo che la memoria contro ErkM e altri antigeni persisteva come conseguenza della terapia combinata di successo ed era sufficiente per mediare la protezione contro un rechallenge con cellule CMS5 parentali o ErkM-negative. Inoltre, come ulteriore prova di antigeni condivisi in eccezione a ErkM, i topi vaccinati con cellule CMS5r irradiate in modo letale (irrCMS5r) sono stati protetti dalla successiva sfida con cellule CMS5 o CMS5r (Figura 5F).

Per determinare quale popolazione di linfociti era necessaria per la protezione contro CMS5r, abbiamo effettuato la deplezione mediata da anticorpi di CD8 + , CD4 + o entrambi i sottogruppi di cellule T nei sopravvissuti alla terapia di combinazione prima del rechallenge. L'esaurimento delle cellule CD8 + T ha provocato la crescita del tumore nell'80% degli animali sfidati, mentre tutti i topi che hanno ricevuto anticorpi contro CD4 o entrambe le cellule T CD4 e CD8 hanno sviluppato tumori, causando una sopravvivenza significativamente ridotta in tutti i gruppi di deplezione (Figura 5G). Questi risultati dimostrano che entrambi i sottoinsiemi di cellule T endogene non sono solo fondamentali per prevenire l'emergere o eliminare varianti preesistenti di perdita dell'antigene durante l'ACT, ma anche per formare un'immunità protettiva a lungo termine con un'ampia specificità dell'antigene.

Il requisito dei linfociti T endogeni per prevenire la recidiva tumorale non è antigene e/o modello dipendente. Infine, abbiamo cercato di valutare la piattaforma combinata di ACT più vaccinazione OV in un diverso modello di tumore per determinare il ruolo dei linfociti T endogeni nel raggiungimento di una regressione tumorale completa e duratura. A tal fine, abbiamo scelto di utilizzare VacV come spina dorsale virale oncolitica per codificare un neoantigene surrogato gp33, il peptide immunodominante della glicoproteina del virus della coriomeningite linfocitaria e una linea cellulare di melanoma murino B16 progettata per esprimere gp33 (B16-gp33). Topi C57BL/6 con d.i. I tumori B16-gp33 sono stati trattati con Tcm derivato da cellule T transgeniche P14 TCR gp33-specifiche seguite dalla vaccinazione VacV-gp33. Come mostrato nella Figura 6A, è stata ottenuta una regressione tumorale completa e duratura nei topi che hanno ricevuto una terapia combinata, confermando la potenza e la flessibilità di questa piattaforma combinata per colpire diversi antigeni tumorali e/o incorporare diversi backbone OV. È interessante notare, tuttavia, che i topi trattati con l'anticorpo anti-Thy1.2 o con CPX prima della terapia di combinazione hanno mostrato una sopravvivenza significativamente ridotta a causa della recidiva del tumore dopo la regressione iniziale (Figura 6, A e B), rafforzando l'importanza dei linfociti T dell'ospite preesistenti che probabilmente ampliare la diversità dell'attacco immunitario.

La necessità di linfociti T endogeni per prevenire la recidiva tumorale è evidenziata in un modello diverso. Topi C57BL/6 con i.d. di 6 giorni Ai tumori B16-gp33 è stato somministrato ACT (10 6 gp33 Tcm specifico) seguito da vaccinazione con 5 × 10 7 PFU VacV-gp33 (entrambi dati e.v.). Gli anticorpi sono stati somministrati 1 giorno prima e 1 giorno dopo il trasferimento delle cellule T e successivamente una volta alla settimana per 3 settimane. Una singola iniezione di CPX è stata somministrata 1 giorno prima dell'ACT. (UN) Volumi tumorali e (B) la sopravvivenza è stata monitorata e mostrata. I dati sono mostrati come risultati rappresentativi di 2 esperimenti indipendenti con n = 5 per gruppo. I dati sono stati analizzati utilizzando un test log-rank (Mantel-Cox) (B). *P < 0,05 **P < 0.01.

Sono attualmente in fase di sviluppo strategie per aumentare selettivamente la reattività delle cellule T contro neoantigeni geneticamente definiti (29, 30). Nel presente studio, abbiamo esplorato una piattaforma terapeutica che combina cellule T neoantigene specifiche (ACT) espanse ex vivo con un OVV. Questa strategia impiega un meccanismo "push-pull" in cui l'OVV facilita sia l'attivazione che l'espansione delle cellule T nella periferia (push), seguita dal reclutamento delle cellule T nel sito del tumore (pull). Infatti, abbiamo dimostrato che il trasferimento adottivo di Tcm antigene-specifico seguito da un vaccino oncolitico ha suscitato una robusta espansione delle cellule T, infiltrazione del tumore e completa regressione del tumore, rivelando una potente sinergia tra questi 2 approcci terapeutici. Ancora più importante, l'efficacia è stata ottenuta in assenza di precondizionamento (cioè, irradiazione corporea totale o chemioterapia linfodepletiva prima del trasferimento cellulare) e adiuvanti esogeni di IL-2, 2 che sono tipicamente impiegati in altri contesti ACT (15, 16), evidenziando l'implicazione traslazionale della nostra terapia di combinazione che può offrire un'esperienza meno intensiva per il paziente. Inoltre, e soprattutto, bypassare il precondizionamento preserva le cellule T endogene innescate dal tumore che non solo completano l'ACT per eliminare il tumore primario e prevenire l'emergere di varianti di perdita dell'antigene, ma formano anche un pool di memoria a lungo termine per la sorveglianza immunitaria.

Nonostante il successo nel trattamento dei tumori maligni delle cellule B e del melanoma, l'ACT ha solo effetti limitati sulla maggior parte dei tumori solidi (31, 32). Gli ostacoli includono, tra gli altri aspetti, l'inefficienza delle cellule T trasferite nell'infiltrare il tumore in quantità sufficiente e nel persistere abbastanza a lungo da uccidere tutte le cellule maligne (33, 34). L'aumento della dose di cellule trasferite può migliorare la loro capacità di accedere e uccidere i tumori solidi, ma la generazione di un gran numero di cellule T ex vivo richiede un'ampia espansione che inevitabilmente porta alla differenziazione terminale e alla senescenza replicativa delle cellule T (35, 36). Inoltre, il microambiente altamente soppressivo e il panorama antigenico eterogeneo associati ai tumori solidi spesso rendono inefficaci le cellule T e promuovono la fuga dell'antigene (37, 38). Pertanto, per ottenere una regressione sostenuta dei tumori solidi, l'ACT deve essere combinato con altri approcci che possono simultaneamente stimolare l'espansione delle cellule T, reclutare cellule T nel tumore, superare l'immunosoppressione mediata dal tumore e ampliare lo spettro della specificità delle cellule T. Abbiamo precedentemente dimostrato che i vaccini oncolitici possono espandere efficacemente il Tcm tumore-specifico mantenendo le loro proprietà oncolitiche benefiche, il che ci ha portato a ipotizzare che gli OVV potrebbero rappresentare una piattaforma ideale per la combinazione con l'ACT a causa della loro vaccinazione e delle funzioni oncolitiche (18, 19). In effetti, forniamo prove in questo studio che né l'OV (nessun antigene tumorale) né il vaccino convenzionale (non noncolitico) erano sufficienti per sinergizzare con l'ACT e che la distruzione dei tumori solidi stabiliti richiedeva sia l'amplificazione che l'infiltrazione tumorale delle cellule T trasferite. A tal fine, i Tcm erano superiori al Teff per la loro efficiente capacità di attecchimento e proliferazione, coerente con un concetto sempre più apprezzato nel campo dell'ACT ( 35 , 36 ).

Abbiamo fatto 2 osservazioni aggiuntive che potrebbero avere importanti implicazioni nell'attuale pratica clinica e nella progettazione razionale dell'ACT. Innanzitutto, sebbene la regressione del tumore sia stata ottenuta in topi immunodeficienti dopo la vaccinazione ACT più OV, i tumori si sono ripresentati entro 2 settimane. Era evidente che le cellule tumorali recidivate non ospitavano più l'epitopo bersaglio delle cellule T trasferite. Questo risultato sembra supportare l'idea che il targeting di tumori con una popolazione di cellule T specifica per un set ristretto di antigeni possa portare alla crescita selettiva di varianti tumorali antigene-negative. Tuttavia, negli animali WT è stata costantemente ottenuta una regressione durevole, suggerendo che l'eterogeneità del tumore e/o la fuga immunitaria possono essere affrontate mobilizzando le cellule T endogene durante l'ACT, anche prendendo di mira un singolo antigene. La nostra osservazione che l'esaurimento delle cellule T CD4 + o CD8 + prima del trattamento con ACT più OV non ha influenzato la regressione del tumore iniziale, ma ha portato alla ricaduta, suggerisce che esiste una cooperazione tra le cellule T trasferite e le cellule T endogene. Sembra che le cellule T trasferite svolgano un ruolo primario nel mediare il debulking del tumore (eradicazione delle cellule tumorali ErkM +), mentre le cellule T endogene sono necessarie per eliminare le varianti sfuggite (ErkM - cellule tumorali). Un possibile meccanismo che spiega l'attivazione delle cellule T endogene è la diffusione dell'epitopo, un fenomeno che coinvolge la presentazione incrociata in vivo di antigeni derivati ​​dal tumore rilasciati in un'ondata di attacco immunitario per promuovere cicli successivi di cellule T antitumorali contro antigeni diversi (14, 39). Questi eventi sequenziali possono essere particolarmente efficaci nel nostro caso a causa della robusta lisi tumorale e dell'infiammazione mediata da cellule T e OV trasferite. Tuttavia, un altro meccanismo plausibile è che le cellule T preesistenti innescate dal tumore vengono liberate e/o espanse dalla terapia ACT più OV, fornendo così un repertorio più ampio per completare le cellule T trasferite per l'eradicazione completa di tutte le cellule tumorali. Quest'ultima possibilità è supportata da diverse linee di evidenza. Innanzitutto, la presenza e il potenziamento delle cellule CD8 + T specifiche per ErkM potrebbero essere rilevate già 2 giorni dopo ACT più OVV. In secondo luogo, l'aumento delle risposte delle cellule T ai neoepitopi non mirati si è manifestato anche 5 giorni dopo la terapia di combinazione. È improbabile che queste osservazioni siano il risultato della diffusione dell'epitopo che richiede l'attivazione di cellule T naive. Inoltre, il fatto che l'esaurimento delle cellule T CD4 + o CD8 + 6 giorni dopo il trattamento non abbia comportato una ricaduta suggerisce che le cellule T preesistenti, ma non successivamente indotte, siano coinvolte nella clearance precoce delle cellule tumorali in collaborazione con le cellule T trasferite. Tuttavia, è probabile che ACT più OV possa sia rinvigorire le cellule T antigene-specifiche preesistenti sia indurre nuove risposte delle cellule T attraverso la diffusione degli epitopi in modo sequenziale che riflette la loro importanza relativa durante la generazione dell'immunità antitumorale (39, 40). È necessario ulteriore lavoro in entrambi gli scenari per determinare se quegli antigeni non identificati riconosciuti dalle cellule T in via di sviluppo naturale o indotte terapeuticamente sono derivati ​​da mutazioni tumore-specifiche o auto-antigeni.

In secondo luogo, la persistenza a lungo termine delle cellule T trasferite è considerata importante ed è stato riportato che esiste una correlazione positiva tra la regressione del tumore e il grado di persistenza dei cloni di cellule T trasferite adottivamente (41, 42). È interessante notare, tuttavia, che le nostre cellule CD8 + T anti-ErkM trasferite sono scomparse subito dopo la regressione del tumore, mentre le cellule CD8 + T endogene specifiche di ErkM sono sopravvissute a lungo termine e sono state in grado di fornire un'immunità protettiva antigene-specifica. Ipotizziamo che l'osservazione nel nostro studio sia dovuta all'introduzione della vaccinazione oncolitica che non solo accelera le risposte delle cellule T trasferite e intensifica le loro interazioni con i tumori, ma coinvolge anche le risposte delle cellule T antitumorali endogene. Infatti, abbiamo dimostrato che le cellule T trasferite dominavano l'espansione precoce e l'infiltrazione del tumore ed erano responsabili della mediazione della regressione iniziale del tumore. Di conseguenza, le cellule T trasferite hanno subito l'apoptosi indotta dal tumore, un fenomeno documentato da studi precedenti (43, 44). Al contrario, l'espansione delle cellule T endogene non ha raggiunto il suo picco fino a diversi giorni dopo la regressione del tumore, suggerendo che la maggior parte delle cellule T endogene potenziate e/o indotte terapeuticamente non ha avuto interazioni con le cellule tumorali e quindi è sopravvissuta per mantenere l'immunità antitumorale. Il fatto che le cellule T trasferite nei topi TF siano sopravvissute a lungo termine conferma che il destino di breve durata delle cellule T trasferite nei topi TB è probabilmente il risultato della loro interazione con le cellule tumorali. I nostri risultati sostengono che preservare le cellule T reattive al tumore endogene durante l'ACT è vitale per garantire l'eliminazione della malattia e la memoria antitumorale a lungo termine, che può essere compromessa dal precondizionamento nel tentativo di aumentare la sopravvivenza delle cellule trasferite adottivamente (16).

Collettivamente, i nostri dati supportano la possibilità di sfruttare il repertorio delle cellule T impegnando i linfociti T dell'ospite innescati dal tumore durante l'ACT e quindi riducendo al minimo o addirittura eliminando il rischio di escrescenza antigene-negativa che risulta dall'introduzione di una singola pressione selettiva. Il fatto che molti pazienti abbiano cellule T CD4 + e/o CD8 + che riconoscono diversi neoepitopi derivati ​​da tumori propri dei pazienti sottolinea la rilevanza dei nostri risultati (45, 46). Sebbene resti da vedere come i nostri risultati possano essere tradotti in clinica dai modelli murini, ci sono prove crescenti della rilevanza della diffusione dell'antigene indotta da OV e dello sviluppo di risposte endogene delle cellule T in parallelo con ACT nella clinica ( 47 , 48 ). Inoltre, sono state sviluppate metodologie cliniche per generare Tcm tumore-specifico da pazienti oncologici, insieme a profili di sicurezza stabiliti di vari OV, supportando l'idea che la nostra terapia di combinazione sia altamente traducibile clinicamente (7 – 9, 49, 50).

Animali. I topi BALB/c o C57BL/6 sono stati acquistati dai Charles River Laboratories e alloggiati in una stanza specifica priva di agenti patogeni nella McMaster University Central Animal Facility. NRG (NOD.Cg-Rag1 tm1Mamma Il2rg tm1Wjl /SzJ) sono stati acquistati dal Jackson Laboratory e i topi sono stati allevati in condizioni ultrapulite. I topi DUC18 sono stati forniti da Lyse Norian (University of Iowa, Iowa City, Iowa, USA) ( 22 ). I topi B6.Cg-Tcratm1Mom Tg (TcrLCMV)327Sdz (P14) sono stati acquistati dai Taconic Breeding Laboratories.

Vettori virali. Il VSV ricombinante è stato ingegnerizzato per esprimere un epitopo ristretto di H-2K d corrispondente agli amminoacidi 136-144 di una proteina ERK2 mutata (ErkM136–144), e il vettore del vaccino VSV risultante è stato chiamato VSV-ErkM. VSV-MT è un vettore di controllo privo di transgene. Ad-ErkM è un vettore adenovirale con deficit di replicazione, deleto E1/E3, contenente l'epitopo ErkM. VacV-gp33 è un VacV ricombinante deleto con TK (ceppo della riserva occidentale) che esprime gp33, un epitopo ristretto di H-2D derivato dalla glicoproteina del virus della coreomeningite linfocitaria ( 51 ).

Peptidi. I peptidi per ErkM (QYIHSANVL), gp33 (KAVYNFATM), Alkbh6.2 (DVPMEQPR), Slit3 (GFHGCIHEVI), Atxn10.1 (QVFPGLMEI) e Ccdc136 (ELQGLLEDEI) sono stati acquistati da Biomer Technologies e disciolti in PBS integrato con 0,5% BSA .

Linee cellulari e sfida tumorale. Tutte le cellule sono state mantenute a 37°C in atmosfera umidificata con 5% CO2. Le cellule CMS5 (un regalo di Lyse Norian) ( 22 ), CMS5r e CMS5r-LVErkM sono state coltivate in DMEM integrato con 10% FBS, penicillina/streptomicina (100 U/mL e 100 ng/mL, rispettivamente) e 2 mM l -glutammina (Thermo Fisher Scientific). Le cellule B16-gp33 (cellule B16F10 stabilmente trasfettate con un minigene corrispondente al peptide gp33) ( 52 ) sono state mantenute in MEM/F11 contenente il 10% di FBS, 2 mM l -glutammina, 5 ml di piruvato di sodio, 5 ml di aminoacidi non essenziali, 5 ml di soluzione vitaminica (Thermo Fisher Scientific), 55 μM di 2-mercaptoetanolo (Sigma-Aldrich), 100 U/ml di penicillina e 100 ng/ml di streptomicina.

Le cellule tumorali sono state lavate due volte con PBS e risospese in PBS a una concentrazione di 10 6 cellule/30 μL per le cellule CMS5 o 10 5 cellule/30 μL per le cellule B16-gp33. I topi sono stati sfidati tramite i.d. iniezione e i tumori sono stati lasciati crescere fino a un volume medio di circa 150 mm 3 prima dell'inizio del trattamento. Le cellule CMS5 recidivate (denominate CMS5r) sono state ottenute da topi NRG end-point. CMS5r-LVErkM sono stati generati tramite trasduzione di CMS5r con un lentivirus ingegnerizzato per esprimere il peptide ErkM mediante ricottura di primer fosforilati 5′ (ErkM, forward, GATCCATGCAATACATACACTCAGCTAACGTGTTGTAAG ErkM, reverse, AATTCTTACAACACGTTAGCTGAGTGTATGTATTGCATG) prima della legatura BamHIo e EcoRI siti di pLV-EF1a-IRES-Puro (plasmide 8513 da Addgene ref. 53). Dopo la trasduzione, è stata generata una linea cellulare policlonale utilizzando la selezione di puromicina (Invitrogen).

Per esperimenti di vaccinazione con irradiazione letale, le cellule CMS5r sono state tripsinizzate, sospese in PBS a 3 × 10 7 cellule/mL ed esposte a 150 Gy utilizzando un Gammacell 1000 (Best Theratronics Ltd.) con una sorgente Cs-137 prima dell'i.d. iniezione di circa 10 6 cellule per topo. I topi sono stati vaccinati due volte a intervalli di una settimana e stimolati con 2 × 10 5 cellule vive 1 settimana dopo la seconda vaccinazione.

Analisi PCR. Il DNA genomico è stato estratto dalle cellule CMS5, CMS5r e CT26 utilizzando i kit di estrazione del DNA genomico Purelink (Life Technologies) secondo le istruzioni del produttore. La PCR è stata eseguita sul DNA estratto utilizzando primer ERK2 (ERK2, forward, 5′-TGTGCCGTGTTCTCTTCAGT-3′, ERK2, reverse, 5′-TGACTTGGCTGACCTTGAGA-3′) con il kit Q5 High-Fidelity DNA Polymerase (New England Biolabs) per le istruzioni del produttore, su un termociclatore T3000 (Biometra). Il programma di amplificazione è stato il seguente: 98°C per 30 secondi, poi 98°C per 10 secondi, 58°C per 30 secondi, 72°C per 30 secondi (×35 cicli), con allungamento finale a 72°C per 2 minuti. I prodotti di amplificazione sono stati digeriti con Sfc1 e fatti funzionare su un gel di agarosio UltraPure all'1% (Life Technologies) con tampone/colorante di caricamento EZ-Vision (Amresco). Il prodotto della PCR da ciascuna linea cellulare è stato sequenziato utilizzando il primer diretto sopra descritto.

Differenziazione delle cellule T in vitro. Gli splenociti sfusi da topi transgenici sono stati isolati e coltivati ​​per 7 giorni in presenza di 100 ng/mL di ErkM o peptide gp33. Per la differenziazione del Tcm, alla coltura sono stati aggiunti 10 ng/mL IL-15, 10 ng/mL IL-21 (BioLegend) e 20 ng/mL rapamicina (Sigma-Aldrich), mentre 60 unità/mL IL-2 (BioLegend ) è stato utilizzato per produrre Teff.

Terapia combinata. Quando i tumori hanno raggiunto un volume medio approssimativo di 150 mm 3 , sono state iniettate cellule T transgeniche CD8 + differenziate in vitro i.v. in topi TB ad una dose di 10 6 cellule/200 μL di PBS. Dopo 24 ore, i topi sono stati trattati con diversi vaccini. I vettori VSV (2 × 10 8 PFU) e vaccinia (7 × 10 7 PFU) sono stati somministrati i.v. e Ad-ErkM (5 × 10 8 PFU) è stato iniettato per via intramuscolare. La vaccinazione peptidica consisteva in 150 μg di peptide sintetico di Erk, 100 μg di anti-CD40 Ab (clone FGK4.5/FGK45, Bio X Cell) e 50 μg di poli-IC (Sigma-Aldrich), somministrati come una miscela tramite i.v. percorso come precedentemente ottimizzato da Cho et al. (25).

Colorazione superficiale e intracellulare dei linfociti T. I seguenti coloranti e Abs per l'analisi citometrica a flusso sono stati acquistati da BD Biosciences: blocco Fc (catalogo 553141), 7AAD (catalogo 559925), Fixable Viability Stain 510 (catalogo 564406), Pacific Blue rat anti-mouse CD8a (clone 558106), APC ratto anti-topo IFN-γ (clone XMG1.2), PE ratto anti-topo CD4 (clone GK1.5), PE mouse anti-ratto Thy1.1 (clone OX-7), Alexa Fluor 700 ratto anti-topo CD62L (clone MEL-14), e FITC ratto anti-topo CD44 (clone IM-7). Campioni di sangue, milza e midollo osseo sono stati raccolti e trattati con tampone di lisi ACK per rimuovere i globuli rossi prima della stimolazione e/o della colorazione del peptide. Le cellule sono state trattate con Fc Block e colorate per i marcatori di superficie, seguite dalla colorazione della vitalità.Per l'analisi delle risposte antigene-specifiche, le PBMC sono state estratte da campioni di sangue utilizzando tampone di lisi RBC e stimolate con ErkM o peptide gp33 (1 μg/mL) in coltura a 37 ° C per 4 ore. Brefeldin A (GolgiPlug, BD Biosciences 1 μg/mL) è stata aggiunta per le ultime 3 ore di incubazione. Il blocco e la colorazione della superficie sono stati eseguiti come sopra, tranne per il fatto che le cellule sono state colorate con colorante di vitalità fissabile prima della fissazione/permeabilizzazione (Cytofix/Cytoperm, BD Biosciences) e la fluorescenza della colorazione intracellulare è stata rilevata utilizzando un citometro a flusso BD LSRFortessa o LSR II (BD Biosciences) . I dati sono stati analizzati utilizzando il software di analisi della citometria a flusso FlowJo (versione 10) (Tree Star).

Test di citotossicità. Le cellule CMS5r-LVErlM sono state etichettate con 5 μM CFSE (MilliporeSigma, catalogo 21888), seminate in una piastra da 96 pozzetti a 10 5 cellule per pozzetto e co-coltivate con DUC18 Teff (generato come sopra) ai rapporti indicati per 16 ore. Le cellule sono state colorate con eBioscience Fixable Viability Dye eFluor 780 (catalogo 65-0865-14, Thermo Fisher) e la colorazione è stata valutata mediante citometria a flusso come sopra. La percentuale di lisi specifica è stata quindi calcolata utilizzando la seguente equazione: % di lisi specifica = 100 × (% morte cellulare specifica – % morte cellulare basale)/100 – % morte cellulare basale, dove la morte cellulare specifica è determinata dalla colorazione della vitalità cellulare di CFSE -cellule positive nei pozzetti di cocoltura delle cellule T e morte delle cellule basali da pozzetti privi di cellule T in cocoltura

Deplezione in vivo dei linfociti T. L'esaurimento delle cellule T è stato ottenuto da 2 i.p. iniezioni di anti-topo CD4 e CD8 (prodotto da ibridomi GK1.5 e 2.43, rispettivamente, acquistati da ATCC) o anticorpo Thy1.2 (clone 30H12, Bio X Cell) alla dose di 250 μg/200 μL distanziati di 48 ore l'uno dall'altro . Il trattamento con l'anticorpo di controllo isotipico (clone HRPN, Bio X Cell) ha seguito lo stesso schema. Per osservazioni più lunghe, l'esaurimento è stato mantenuto utilizzando un bisettimanale i.p. iniezione di anticorpi corrispondenti. CPX (Sigma-Aldrich) era i.p. somministrato 1 giorno prima del trasferimento delle cellule T alla dose di 3 mg/topo. L'efficienza di esaurimento è stata monitorata mediante analisi FACS di PBMC in diversi momenti durante il trattamento (dati non mostrati).

Istologia. L'immunoistochimica è stata eseguita su sezioni di tessuti tumorali fissati in formalina e inclusi in paraffina utilizzando un coloratore automatico Leica Bond Rx (Leica Biosystem). I vetrini sono stati deparaffinati e pretrattati con il tampone Leica Bond Epitope Retrieval #2 (Leica Biosystems) per 20 minuti prima della colorazione con l'anticorpo anti-topo CD8α di ratto (clone 4SM15 diluito 1:1000, Thermo Fisher Scientific). Il colore è stato sviluppato utilizzando il Leica Bond Polymer Refine Detection Kit (Leica Biosystems), sostituendo il componente post-primario con l'anticorpo di coniglio anti-ratto (1:100, Vector Laboratories). Le immagini sono state scattate utilizzando un microscopio Axiovert 100M (Zeiss) e la quantificazione è stata eseguita utilizzando la funzione di analisi delle particelle del software ImageJ (54).

Statistiche. GraphPad Prism per Windows è stato utilizzato per grafici e analisi statistiche. Le differenze tra i mezzi di dati sulla risposta immunitaria sono state interrogate utilizzando uno Student's a due code accoppiato T test, ANOVA a 1 via o ANOVA a 2 vie per misure ripetute come descritto nelle legende delle figure. Ove necessario, è stato utilizzato il metodo Holm-Šidák per correggere confronti multipli. Nel complesso, a P valore inferiore a 0,05 è stato considerato significativo. Vengono mostrate le barre media + SD. Le curve di sopravvivenza sono state generate utilizzando il metodo Kaplan-Meier, con un volume tumorale di 1000 mm 2 o ulcerazione tumorale come punto finale e analizzate utilizzando il test log-rank (Mantel-Cox).

Approvazione dello studio. Tutti gli esperimenti sugli animali erano conformi alle linee guida del Canadian Council on Animal Care e hanno ricevuto l'approvazione interna tramite il Consiglio etico per la ricerca sugli animali della McMaster University.

SRW, BS, LC, DB, AN e TSM hanno eseguito gli esperimenti, analizzato i dati e aiutato nella preparazione del manoscritto. KS e BDL hanno costruito i vettori virali e hanno assistito nell'analisi dei dati. JLB, SRW e YW hanno supervisionato la progettazione sperimentale e l'interpretazione dei dati e hanno preparato il manoscritto.

Ringraziamo Lyse Norian per aver fornito topi DUC18. Questo studio è stato condotto con il supporto dell'Ontario Institute for Cancer Research attraverso finanziamenti forniti dal governo dell'Ontario, nonché dai Canadian Institutes of Health Research (FRN 123516 e FRN 152954), dalla Canadian Cancer Society (concessione 705143) e il Terry Fox Research Institute (TFRI-1073).

Conflitto d'interesse: SRW, BS, LC e YW sono inventori sulla domanda di brevetto n. CA2017/050772 (numero di pubblicazione WO/2017/219150), presentato dalla McMaster University, che copre l'uso della terapia con cellule T adottive e della terapia combinata di vaccinazione contro il virus oncolitico.


Guarda il video: How to hold Lab Mice (Dicembre 2021).