Informazione

Quantità di eterozigosi

Quantità di eterozigosi


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

Quanti loci nel genoma umano sono eterozigoti? E le altre specie?

MODIFICARE:
Mi chiedevo, considerando ad esempio l'intera popolazione mondiale, quanti dei geni umani hanno effettivamente due o più alleli diversi, o, viceversa, quali geni condividono tutti perché non ne esistono versioni diverse. Dal momento che questo non sembra essere chiaro, non considero una mutazione in un singolo individuo un allele, forse prendo l'1% di occorrenza tra tutti gli individui come inizio? Non sono un biologo però...

Per loci intendo qualunque cosa tu pensi abbia senso. Di nuovo, non intendo basi singole, preferibilmente qualcosa come l'idea classica di un gene. Ma sono felice per quello che puoi dirmi.


Se vuoi un numero effettivo, beh, dipende (ovviamente). Prima di tutto, qual è la tua definizione di loci? Quel termine è ampio e può essere interpretato per significare qualsiasi cosa, dai grandi geni di lunghezza megabase a ogni singola base.

Detto questo, si scopre che ci sono alcune serie serie di omozigosi (ROH, che significa lunghe regioni del genoma che sono omozigoti) nelle popolazioni umane. Questo ovviamente varierà ampiamente da popolazione a popolazione e tra individui di razza. Questo documento contiene alcune cifre FANTASTICHE che vale la pena verificare ma sono un po' più coinvolte. Ecco una tabella di questo articolo, che è parimenti eccellente; inoltre, controlla la figura 3.

MODIFICARE

La tua domanda nuova/modificata è in realtà molto difficile a cui rispondere. Per un esempio estremo, guarda l'antigene leucocitario umano; alcuni hanno centinaia o migliaia di alleli, ma se tu fossi omozigote per ciascuno di essi sarebbe un male (suscettibilità alle malattie) ma staresti bene altrimenti.

Ancora una volta, dipende da cosa consideri un allele o un locus. La maggior parte degli studi esamina i cambiamenti di base singola (SNP) perché sono 1. facili e 2. utili. Si scopre che ci sono Un sacco di questi singoli cambiamenti. Il progetto Human HapMap sta lavorando duramente su questo e ha recentemente pubblicato un set di dati con 3,1 milioni di questi SNP, tra 270 individui di diverse popolazioni, circa uno ogni kilobase. In modo simile, il progetto 1000 genomes ha recentemente pubblicato un enorme catalogo di variazioni di quasi 1.110 individui in 14 popolazioni. Entrambi i progetti si sono concentrati su varianti principali.

La migliore risposta che posso darti da questi studi è che, all'interno di una data popolazione, due filamenti di DNA sono identici per circa l'80%, di cui circa lo 0,5% per relazione diretta (tabella 5. Questi numeri variano enormemente tra le popolazioni, con i nigeriani Yoruba che sono i più diversificati, seguiti dai bianchi dello Utah e poi dai cinesi Han e dai giapponesi di Tokyo. Questa è solo una media dell'intero genoma, poiché le presunte differenze funzionali sono relativamente rare, con oltre l'85% dei cambiamenti che alterano le proteine ​​​​sono molto rari (frequenza <0,5%).

In sintesi, quasi ogni singolo sito che conosciamo ha più di una versione da qualche parte. La maggior parte dei tratti sono molto complessi e sono influenzati da molti geni, quindi anche aspetti simili possono derivare da genetiche molto diverse. Gli individui tendono ad essere altamente eterozigoti, anche se le popolazioni nel loro insieme hanno un'eterozigosi limitata. Un singolo accoppiamento di fratelli e sorelle può produrre enormi difetti, mostrando quanto sia necessaria la nostra eterozigosi. Ognuno di noi ha dozzine di grandi mutazioni letali (delezioni, per lo più) che di solito non contano grazie all'eterozigosi.


Il numero di possibili genotipi da pochi loci è grande e può essere calcolato usando la formula

k(k+1)/2

dove k è il numero di alleli in un particolare locus.

Il parametro k rappresenta anche il numero atteso di genotipi omozigoti, e k[(k-1)/2] rappresenta il numero atteso di genotipi eterozigoti. L'eterozigosi osservata può essere paragonata all'eterozigosi attesa e le deviazioni tra questi valori possono indicare importanti dinamiche di popolazione.


Quantità di eterozigosi - Biologia

eterozigosi, hScadenza (o diversità genetica, D)

L'eterozigosi è di grande interesse per gli studiosi della variazione genetica nelle popolazioni naturali. Spesso è uno dei primi "parametri" che si presenta in un set di dati. Può dirci molto sulla struttura e persino sulla storia di una popolazione. Ad esempio, eterozigosità molto basse per i loci allozimi nei ghepardi e nei furetti dai piedi neri indicano gravi effetti di piccole dimensioni della popolazione (colli di bottiglia della popolazione o dinamiche di metapopolazione che hanno ridotto gravemente il livello di variazione genetica rispetto a quello atteso o riscontrato in mammiferi comparabili). Elevata eterozigosità significa molta variabilità genetica. Bassa eterozigosi significa poca variabilità genetica. Spesso, confronteremo il livello di eterozigosi osservato con quello che ci aspettiamo sotto l'equilibrio di Hardy-Weinberg (HWE). Se l'eterozigosi osservata è inferiore al previsto, cerchiamo di attribuire la discrepanza a forze come la consanguineità. Se l'eterozigosi è maggiore del previsto, potremmo sospettare un effetto di rottura dell'isolato (la mescolanza di due popolazioni precedentemente isolate).

Esistono diverse misure di eterozigosi. Il valore di queste misure varierà da zero (nessuna eterozigosi) a quasi 1,0 (per un sistema con un gran numero di alleli ugualmente frequenti). Ci concentreremo principalmente sull'eterozigosi attesa (hE, o diversità genetica, D, come preferisce chiamarlo Bruce Weir). Il modo più semplice per calcolarlo per un singolo locus è:

Perché funziona prendere la somma delle frequenze geniche al quadrato e sottrarle da una? Ripensiamo all'Hardy-Weinberg di base:

Cosa ci dice l'eterozigosi e quali modelli emergono quando passiamo ai sistemi multi-allelici? Facciamo un esempio. Dire P = Q = 0,5. L'eterozigosi per un sistema a due alleli è descritta da una parabola concava verso il basso che inizia da zero (quando P = 0) va al massimo a P = 0.5 e torna a zero quando p = 1. Infatti, per qualsiasi sistema multi-allelico, l'eterozigosi è massima quando

Visione dell'eterozigosi dall'occhio dell'individuo

Ecco un modo in cui mi piace pensare all'eterozigosi (hE o D). È la probabilità (prevista) che un individuo sia eterozigote in un dato locus (o sui loci analizzati per un sistema multi-locus). Per molti loci microsatelliti umani, ad esempio, hE è spesso > 0,85, il che significa che hai una probabilità > 85% di essere eterozigote.

Ora che hai un modo per calcolare la diversità genetica/l'eterozigosi attesa, sei pronto per calcolare F-statistiche con il metodo di:

Se esegui alcuni dati tramite Eqns 4.5 e un programma di analisi, potresti chiedere:


Esempi di eterozigote

Individui eterozigoti e tratto falciforme

L'anemia falciforme è una malattia recessiva che causa la formazione non corretta delle cellule del sangue. Invece di un ampio disco rotondo, le cellule hanno la forma di una falce o mezzaluna. Le celle non funzionano correttamente in questa forma. L'anemia, o la condizione del sangue che non trasporta abbastanza ossigeno, è una condizione grave nelle persone con due tratti recessivi delle cellule falciformi. La condizione può anche causare ictus, dolore e coagulazione nel flusso sanguigno. Tuttavia, gli individui eterozigoti con il tratto falciforme non soffrono di questi disturbi. L'unico allele normale che hanno produce abbastanza globuli rossi per mantenerli sani. Di seguito è riportata un'immagine delle cellule normali rispetto alle cellule falciformi nel flusso sanguigno.

Anche se può sembrare che gli individui eterozigoti siano ancora in grande svantaggio, in realtà c'è un vantaggio interessante del tratto falciforme. Gli individui con un solo allele falciforme producono ancora un bel po' di cellule falciformi, ma non abbastanza da farli ammalare. Tuttavia, quando il parassita della malaria infesta il corpo, attacca e risiede nelle cellule del sangue. Si pensa che le cellule falciformi collassino attorno al parassita e rendano più facile per il corpo filtrare il parassita dal sangue. Gli individui più eterozigoti sono in grado di sopravvivere alla malaria in questo modo. Gli scienziati pensano che questo sia il motivo per cui l'allele falciforme ha una frequenza abbastanza alta, specialmente ai tropici dove i casi di malaria sono alti.

Capelli ricci

È interessante notare che quanto sono ricci i tuoi capelli può essere collegato alla genetica. Il gene che ha deciso il fenotipo dell'arricciatura dei capelli produce una proteina che fa crescere le ciocche di capelli sinuose. Un individuo con due alleli recessivi, o due alleli non funzionali, avrà i capelli lisci perché non ci sono proteine ​​che causano il fenotipo dell'arricciatura. Gli individui omozigoti con due alleli ricci avranno i capelli molto ricci. Gli individui eterozigoti hanno un fenotipo da qualche parte nel mezzo, quello che la gente potrebbe chiamare capelli "ondulati". In un individuo eterozigote è presente un solo allele riccio e può essere prodotta solo la metà della quantità di proteine. Questo fa sì che i capelli siano circa la metà dei ricci di un individuo riccio omozigote. Questo è un modello di dominio incompleto.

Gruppo sanguigno

A e B sono dominanti su O, ma codominanti tra loro. AA e AO sono conosciuti come il gruppo sanguigno "A", perché sono presenti solo le proteine ​​"A". BB e BO sono conosciuti come il gruppo sanguigno "B", perché sono presenti solo le proteine ​​"B". Gli individui OO non producono proteine ​​sulle cellule del sangue e possono donare il sangue a chiunque. Negli individui eterozigoti AB, alcune cellule esprimono proteine ​​"A" e alcune esprimono proteine ​​"B". Ciò significa che puoi dare a un individuo eterozigote AB il gruppo sanguigno "A", "B" o "O" e il loro corpo non rifiuterà la donazione. Questo rende l'individuo eterozigote il più facile a cui donare il sangue. Gli individui omozigoti OO potrebbero essere in grado di donare a chiunque, ma non possono ricevere sangue da nessuno se non da un altro donatore OO. Solo un altro vantaggio dell'essere eterozigote.


Test degli eterozigoti e screening dei portatori

24.9 Età per il test del portatore

L'eterozigosi per la maggior parte dei tratti recessivi ha poche o nessuna conseguenza sulla salute dell'individuo ed è solo una questione rilevante per la riproduzione. Per questo motivo, è meglio istituire il test del portatore appena prima o durante l'età riproduttiva. Ciò ha aggiunto vantaggi in quanto è molto più probabile che la capacità della persona di comprendere il significato di tali informazioni sia adeguata a tale età. Allo stesso modo, il test del portatore tra bambini o adolescenti non dovrebbe essere effettuato di routine e dovrebbe essere preso in considerazione solo in circostanze speciali. Il livello di maturità e l'istruzione di base di una persona possono essere fattori importanti per ovviare a qualsiasi possibile stigmatizzazione che l'identificazione del portatore potrebbe comportare. Una richiesta dei genitori per determinare il possibile stato di portatore dei propri figli non deve essere una base sufficiente per procedere. Piuttosto, una discussione completa con i genitori sulla mancanza di implicazioni per la salute e sui possibili rischi psicosociali del test sui giovani può portare a rinviare il test a un momento più appropriato. Per quanto riguarda i disturbi ad esordio nell'età adulta, un comitato dell'American Academy of Pediatrics ha raccomandato che le persone di età pari o inferiore a 18 anni vengano testate solo se il test offrirà benefici immediati alla persona sottoposta a test o a un altro membro della famiglia e se non vi è alcun danno anticipato all'individuo sottoposto a test (41) .


Quantità di eterozigosi - Biologia

Glossario e bibliografia dei termini della genetica delle popolazioni e molecolare, della sistematica ecc.
+ fonti di software per computer e una bibliografia limitata

Glossario di termini: (termini sottolineati in blu sono i riferimenti incrociati con collegamenti ipertestuali)

allele : un segmento variante del materiale genetico. Gli organismi diploidi avranno due potenziali alleli per ogni particolare stiramento (gene, sensuale latu) del DNA (ad esempio, un allele "normale" e uno "mutante" per Drosophila caratteristica come il colore degli occhi). Se gli alleli sono gli stessi (o indistinguibili) su entrambi i cromosomi, l'individuo è un omozigote, se gli alleli differiscono, un eterozigote. Bateson e Saunders (1902) originariamente coniarono il termine per tratti alternativi l'uno all'altro nell'ereditarietà mendeliana (Gk. allelone, l'un l'altro morfe, modulo). Ora utilizzato per forme alternative in un locus genetico. Gli alleli codominanti sono particolarmente utili come marcatori genetici.

Allopatrico: avente aree geografiche non sovrapposte. cfr. simpatrico,

allozimi : Varianti proteiche codominanti ( alleli ) che possono essere visualizzate mediante colorazione appropriata ed elettroforesi su gel di amido . Questi sono stati i primi importanti marcatori genetici molecolari, sviluppati alla fine degli anni '60 e '8217.

Assegnazione (test): un metodo per assegnare gli individui alle popolazioni da cui è più probabile che abbiano avuto origine (indipendentemente da dove si sono dispersi o sono stati campionati). Un calcolatore di compiti basato sul web si trova all'indirizzo: http://www.biology.ualberta.ca/jbrzusto/Doh.html. [Vedi anche Davies, N., F.X. Villablanca e G.K. Roderick. 1999. Determinazione dell'origine degli individui: genotipizzazione multilocus nella genetica delle popolazioni di non equilibrio. Tendenze Eco. Evol. 14: 17-21 Waser, PM e C. Strobeck. 1998. Firme genetiche della dispersione dell'interpopolazione. Tendenze Eco. Evol. 13:43-44]. GeneClass di J.M. Cornuet esegue test bayesiani e altri test di assegnazione: http://www.ensam.inra.fr/urlb/

Accoppiamenti assortiti: sistemi di accoppiamento non casuali in cui il simile si accoppia con il simile. cfr. Accoppiamento disassortitivo, Accoppiamento casuale.

Ipotesi: una parte critica di qualsiasi modello della struttura genetica di popolazioni o taxa. La maggior parte dei modelli formula ipotesi semplificative riguardanti la deriva, la mutazione o la linearità che saranno violate in una certa misura da quasi tutti i set di dati effettivi. Il punto chiave è se le violazioni sono sufficienti per invalidare le conclusioni del modello. UN robusto l'analisi è quella le cui conclusioni sono insensibili alle violazioni dei presupposti.

Autosoma: cromosoma diverso da un cromosoma sessuale.

‘Beanbag’ genetica: un termine inizialmente dispregiativo per la base classica della genetica delle popolazioni fondata da Sewall Wright, J.B.S. Haldane e R.A. Pescatore. La manipolazione dei conteggi delle frequenze geniche e genotipiche basata sulle forze di mutazione, deriva, migrazione, selezione e accoppiamento non casuale fornisce le basi per una comprensione teorica dell'evoluzione.

Collo di bottiglia : Riduzione della dimensione della popolazione che può avere una grande influenza sulla variazione genetica a causa della relazione tra deriva genetica e dimensione della popolazione.

bp: Abbreviazione di 'coppie di basi' (nucleotidi).

Cladistica: Scuola di analisi filogenetica che enfatizza i modelli di ramificazione dei taxa monofiletici che si basano su sinapomorfie (vs. simplesiomorfie) per unire i taxa fratelli. [Vedi Avise, pp. 34-39, 121-122].

Cladogramma: un diagramma, sotto forma di albero stilizzato, che mostra modelli storici di ramificazione dedotti tra i taxa.

codominante : espressione di fenotipi eterozigoti che differiscono da entrambi i fenotipi omozigoti. I microsatelliti sono marcatori genetici codominanti, perché si può distinguere un eterozigote (due bande) da ciascuno degli omozigoti (singola banda).

Coefficiente di parentela (R): Una misura del grado di parentela tra gli individui, che va da 𔃉.0 (nessun gene in comune, almeno sui marcatori genetici analizzati) a +1.0 (gemelli identici o cloni). In una popolazione diploide di razza, i fratelli dovrebbero avere R = 0,5, gli individui scelti a caso dovrebbero avere R = 0.0. Questa misura è il fondamento della teoria della selezione parentale di Hamilton (1964), che ha dato il via a una rivoluzione nello studio del comportamento animale, dell'ecologia comportamentale e dell'analisi del fitness. [Vedi Avise p. 191 Queller e buonanotte, 1989].

Congruenza: accordo tra o all'interno di insiemi di dati filogenetici.

diploide : Avere un doppio corredo di cromosomi (generalmente un set paterno e uno materno). Molte analisi genetiche sono condotte su taxa le cui cellule sono generalmente diploidi. Eccezioni alla diploidia includono gameti aploidi, maschi aplo-diploidi negli imenotteri, specie poliploidi (in particolare nelle piante, ma esiste un recente esempio di mammifero!) e stadi aploidi in alcuni cicli di vita complessi.

Accoppiamento disassortitivo: sistema di accoppiamento non casuale in cui a differenza degli individui si accoppiano. cfr. Accoppiamento Assortative, Accoppiamento Casuale.

Dimensione effettiva della popolazione : vedere Ne.

elettroforesi : gel di acetato polarizzato, agarosio o acrilammide attraverso il quale scorre proteine ​​o DNA. Il materiale quindi si separa in base al peso o alla polarità e consente di distinguere le varianti (ad esempio alleli, varianti enzimatiche). [-foresi dal greco per ‘portare’]. [Vedi Avise, Fig. 3.2, p. 48, e Fig. 3.3, p. 50]. Gli allozimi si riferiscono a varianti enzimatiche utilizzate come marcatori genetici.

Endemismo: presente in una sola località ristretta. Le specie insulari sono spesso endemiche (non si trovano sulla terraferma adiacente). Alti livelli di endemismo (ad esempio, piante e invertebrati negli habitat della macchia di pino sabbioso della Florida) suggeriscono una storia di isolamento geografico. Le catene montuose sudamericane, ad esempio, hanno tassi molto elevati di endemismo per piante e animali.

Forze evolutive : Cinque forze principali possono causare un cambiamento evolutivo: MEMORIZZA QUESTI!

Selezione naturale
Deriva genetica (o dimensione della popolazione)
Mutazione
accoppiamento non casuale
Migrazione (nel senso genetico di movimento permanente di geni da un luogo all'altro) Esone: Sezione del DNA che codifica per gli amminoacidi. Vedi introne.

Idoneità: più facile da incapsulare nel senso della genetica della popolazione come il tasso relativo di aumento di un genotipo in base alla sola selezione della vitalità. Metz et al. (1992) discutono il concetto in un articolo TREE, Grafen (1982) discute il fitness inclusivo, Danchin et al. (1995) e McGraw e Caswell (1996) discutono la misurazione della fitness dai dati del mondo reale. Per molti casi, il parametro della popolazione della matrice l può essere preso come misura della fitness (Caswell, 1989, p. pp. 163-171). [Se l > 1 allora il genotipo aumenta, se l < 1 allora diminuisce].

Regione fiancheggiante: per i microsatelliti, le regioni fiancheggianti sono i tratti di DNA al di fuori della ripetizione in tandem di sequenza semplice. Queste sequenze sono usate come coppie di primer. Le regioni fiancheggianti sono solitamente invarianti in una popolazione o specie, ma le mutazioni nella regione fiancheggiante possono essere una causa di alleli nulli così come una fonte potenzialmente seria di omoplasia (vedi Pemberton et al. 1995).

Forense: di o relativo a tribunali o questioni legali. I marcatori molecolari sono sempre più comuni nel contesto della medicina legale, sia nella fauna selvatica che nei casi umani che coinvolgono l'identità o la parentela.

F-statistiche : una misura della struttura genetica sviluppata da Sewall Wright (1969, 1978). Relativo all'analisi statistica della varianza (ANOVA)
F ST è la proporzione della varianza genetica totale contenuta in una sottopopolazione (il pedice S) rispetto alla varianza genetica totale (il T pedice). I valori possono variare da 0 a 1. Alto F ST implica un notevole grado di differenziazione tra le popolazioni.
F IS (coefficiente di consanguineità) è la proporzione della varianza nella sottopopolazione contenuta in un individuo. Alto F IS implica un notevole grado di consanguineità.
Misure correlate: q (theta) di Weir e Cockerham (1984) e G ST di Nei (1973, 1978). [Vedi Weir, 1996 Avise, Box 6.3, p. 206].

Diversità genetica (eterozigosi attesa): una misura della variazione genetica in una popolazione. Viene calcolato dal quadrato delle frequenze del gene (= allele). Vedi Weir (1996) p. 124 per la formula.

Flusso genico : spostamento di geni da una popolazione all'altra, facendoli diventare più simili. La migrazione genetica è l'agente principale del flusso genico.

Frequenze geniche : Il termine utilizzato nella genetica delle popolazioni per le frequenze alleliche.

Distanza genetica: varie statistiche per misurare la 'distanza genetica' tra sottogruppi o popolazioni. Le principali misure di distanza includono la distanza di Nei (1972, 1978), la distanza di Reynolds (Reynolds et al. 1983) e nuove misure di distanza che incorporano il processo di mutazione graduale nei microsatelliti (R ST di Slatkin 1995a, b D di Shriver et al., delta mu di Goldstein et al. 1995).

Deriva genetica : una forza che riduce l'eterozigosi mediante la perdita casuale di alleli. La deriva è inversamente proporzionale alla dimensione della popolazione. Popolazioni infinitamente grandi (un'ipotesi dell'equilibrio di Hardy-Weinberg) non sperimenteranno la deriva, mentre le piccole popolazioni sperimenteranno maggiori effetti della deriva. La deriva è una delle principali forze del cambiamento evolutivo (insieme alla selezione naturale, alla mutazione, alla migrazione genetica e all'accoppiamento non casuale). L'equilibrio/equilibrio tra deriva e mutazione è uno degli obiettivi principali di gran parte della genetica delle popolazioni.

Marcatori genetici : qualsiasi tratto utilizzato come marker di variazione genetica con in e tra individui e taxa. I tratti utilizzati includono tratti fenotipici (colore degli occhi), prodotti proteici ( allozimi , albumina) e segmenti del DNA. Si potrebbe usare un particolare marcatore genetico come tratto diagnostico (questa carne è un alce legale o il toro premio di Rancher Smith? questa persona ha una malattia genetica ereditaria?), come strumento per la gestione (quanto sono diverse le trote nel Wyoming dalle trote nel Colorado?), come ausilio ad analisi sistematiche, o in un'enorme varietà di modi nella biologia evolutiva di base. Diversi marcatori genetici (ad es. microsatelliti, mtDNA, allozimi, RAPD) hanno scopi diversi (analisi a grana fine vs. analisi a grana grossa) e diversi vantaggi e svantaggi (ad es. specificità, costo, facilità di interpretazione analitica dei dati risultanti) .

Dimensione del genoma: Il genoma è il termine collettivo per tutto il complemento di materiale ereditario trovato in un organismo (ad esempio, tutto il DNA nell'insieme dei cromosomi negli eucarioti). La dimensione del genoma varia da circa 10 4 paia di basi ( bp ) in alcuni virus a circa 10 10 in molte piante angiosperme, fino a > 10 10 in alcune salamandre e pesci. I mammiferi hanno circa 2-3 X 10 9 bp. Sebbene la poliploidia possa aumentare le dimensioni del genoma, la maggior parte dell'aumento sembra essere dovuta a eventi di duplicazione relativamente piccoli (perché le dimensioni del genoma all'interno dei taxa tendono ad essere approssimativamente normalmente distribuite attorno a una dimensione modale intermedia. [Vedi Ayala, 1982, pp. 219-22].

Genotipo : L'insieme delle varianti del DNA trovate in uno o più loci in un individuo. Le informazioni da cui vengono sviluppati i genotipi potrebbero includere alleli allozimi, alleli microsatelliti o informazioni sulla sequenza (quindi di solito si fa riferimento agli aplotipi). cfr. fenotipo.

La regola di Haldane: "Quando nella prole F1 di due diverse razze animali un sesso è assente, raro o sterile, quel sesso è il sesso eterozigote [eterogametico]". [Vedi Avise, p. 289].

Aploide: possiede un singolo complemento di cromosomi. Vedi diploide.

Hardy-Weinberg principio: (Hardy-Weinberg Equilibrium è abbreviato HWE) Date alcune ipotesi semplificatrici come nessuna deriva genetica (= dimensione della popolazione infinita), accoppiamento casuale, generazioni non sovrapposte, nessuna selezione e nessuna migrazione (genetica), le frequenze del genotipo in un infinito popolazione può essere prevista dalle frequenze geniche, P e Q dalla formula:

P 2 + 2pq + Q 2 Una popolazione raggiungerà l'equilibrio di Hardy-Weinberg (HWE) in una sola generazione (a meno che non venga violata una delle ipotesi sopra elencate). Testiamo per HWE confrontando le frequenze genotipiche osservate e previste. Una parte sorprendente dell'argomento della genetica delle popolazioni è incentrata su come/perché le popolazioni si discostano da HWE.

Ereditarietà: h 2 = ereditabilità in senso stretto in genetica quantitativa = VUN/VP, dove VUN è la varianza genetica additiva e VP è la varianza fenotipica. L'ereditarietà (in senso stretto) entra nella risposta alla selezione R,
dove R =h 2 S, e S è l'intensità della selezione. Vedi Gillespie (1998) p. 129, Hartl (2000) pp. 166-167.

Sesso eterogametico: il sesso i cui cromosomi sessuali sono diversi l'uno dall'altro. Nei mammiferi, nella maggior parte degli altri vertebrati e nella maggior parte degli insetti, i maschi sono il sesso eterogametico (XY), mentre negli uccelli, nei lepidotteri e in alcuni pesci sono le femmine (WZ). La determinazione del sesso cromosomico non è universale (le alternative sono la determinazione del sesso fenotipico e allelico).

Eterozigosi (prevista) : Un individuo o un parametro a livello di popolazione. La proporzione di loci che si prevede siano eterozigoti in un individuo (compreso tra 0 e 1,0).
h oh (eterozigosi osservata) è la proporzione osservata di eterozigoti, mediata sui loci.
h E (eterozigosi attesa) è anche conosciuta come diversità genica (= D preferito, termine meno ambiguo) ed è calcolato come 1,0 meno la somma delle frequenze geniche al quadrato. [Vedi Weir, 1996, p. 124 per la formula multi-locus, multi-allele].

Omologia: avente la stessa origine (usata per geni o caratteri derivanti da un antenato comune).

Omoplasia: somiglianza di tratti o geni per ragioni diverse dalla coascendenza (ad esempio, evoluzione convergente, parallelismo, inversioni evolutive, trasferimento genico orizzontale, duplicazioni geniche). L'omoplasia viola un presupposto di base dell'analisi dei marcatori genetici: si presume che varianti di fenotipo simile (ad esempio, dimensione della coppia di basi) derivino da un antenato comune. [Vedi Sanderson, M. e Hufford. 1996. Omoplasia: la ricorrenza della somiglianza nell'evoluzione. Academic Press, NY ISBN 618030-X].

Ipervariabilità: alto grado di variazione tra individui all'interno di popolazioni locali in corrispondenza di un dato marcatore genetico. Esempi di marcatori ipervariabili includono minisatelliti e microsatelliti.

Assortimento indipendente: durante la formazione dei gameti, coppie segreganti di fattori unitari (ad es. Di conseguenza, è possibile utilizzare le probabilità moltiplicative per calcolare fenotipi o genotipi multi-tratto o multigene. Lo squilibrio di collegamento può impedire la realizzazione delle probabilità previste.

Individualizzazione: parola d'ordine (in gran parte limitata alle applicazioni forensi) per abbracciare l'idea che i marcatori molecolari possano facilitare la distinzione degli individui.

Introne: le sequenze di DNA all'interno delle sequenze codificanti proteine ​​di un gene, gli introni vengono trascritte nell'mRNA ma vengono eliminate dal messaggio prima che venga tradotto in proteine. Gli introni possono contenere sequenze coinvolte nella regolazione dell'espressione di un gene. Vedi esone.

Rottura dell'isolato: Eccesso di eterozigosi (oltre le aspettative di Hardy-Weinberg) osservata quando popolazioni o sottopopolazioni divergenti stabiliscono un contatto secondario. L'opposto dell'effetto Wahlund.

Isoenzimi: varianti enzimatiche con lo stesso ruolo funzionale, ma che differiscono nella struttura di 1°, 2°, 3° o 4°. In alcuni casi, gli isoenzimi possono essere multimeri prodotti da più geni. Possono, quindi, non qualificarsi come allozimi codominanti per l'uso come marcatori genetici.

Cariotipo: il complemento dei cromosomi (es. 2n = 46 nell'uomo) che costituiscono il materiale genetico di un eucariote.

Ladder: una serie di frammenti di dimensioni note eseguito in un gel per consentire il dimensionamento di frammenti di DNA bersaglio eseguito in altre corsie. Una scala comunemente usata è il taglio lambda fago con un enzima di restrizione [produce frammenti di 216, 211, 200, 164 e 150 bp].

Lambda: il DNA fagico Lambda ( l ) è uno strumento utile nella biologia molecolare. Poiché la sua intera sequenza è nota (= 50Kb a doppio filamento), viene spesso utilizzata per creare una scala di frammenti di dimensioni note per il dimensionamento delle bande sui gel. È anche un utile vettore di clonazione.

luogo : dal latino 'luogo'. Un tratto di DNA in un punto particolare su un particolare cromosoma — spesso utilizzato per un "gene" in senso lato, ovvero un tratto di DNA analizzato per la variabilità (ad esempio, un locus microsatellite).

Microsatelliti : Brevi ripetizioni in tandem (es. AC n , dove n > 8) di sequenze nucleotidiche -- le unità tandem possono essere dinucleotidi, trinucleotidi o tetranucleotidi. Il processo di mutazione apparente avviene per errori di replicazione dello slittamento, in cui le ripetizioni consentono la corrispondenza tramite escissione o aggiunta di ripetizioni. Poiché questo tipo di replicazione da slittamento è più probabile delle mutazioni puntiformi, i loci microsatelliti tendono ad essere ipervariabili. La procedura usuale consiste nell'utilizzare un oligo (ad esempio, AC 10) come sonda, selezionare una libreria genomica e quindi sequenziare i cloni positivi per sviluppare coppie di primer che possono essere utilizzate per amplificare il DNA bersaglio con la PCR. Il nome alternativo è SSTR (ripetizione in tandem di sequenza semplice). [Vedi anche McDonald e Potts (1997), o introduzione di 1 pagina. su http://www.uwyo.edu/zoology/McDONALD.HTM].

Migrazione : Nella genetica delle popolazioni, per migrazione si intende il movimento (permanente) di geni all'interno o all'esterno di una popolazione. Pertanto, un silvia 'migrante' non provoca alcuna migrazione (in senso genetico) spostandosi da zone di riproduzione nel Wyoming a zone di svernamento in Messico e poi tornando a riprodursi nella stessa località del Wyoming. Ci riferiamo al processo dei geni che si spostano tra le popolazioni come flusso genico.

Dimensione minima della popolazione vitale: vedere Nunney, L. e K.A. Campbell. 1993. Valutazione della dimensione minima della popolazione vitale: la demografia incontra la genetica della popolazione. Tendenze Eco. Evol. 8: 234-239.

Minisatelliti: [vedi VNTR]. Segmenti di DNA ripetuti spesso usati come marcatori genetici per l'identificazione individuale ( "impronta digitale" del DNA forense) o analisi di parentela. Può essere singolo o multilocus. La tecnologia dei minisatelliti si basa sull'ibridazione basata su sonde. I vantaggi includono la mancanza di necessità di primer specifici e l'ipervariabilità. Gli svantaggi includono l'incapacità di utilizzare l'amplificazione PCR, la necessità di Southern blotting e, per i minisatelliti multi-locus, la mancanza di specificità del locus (rendendo difficili le analisi genetiche di popolazione). [Vedi Avise, Fig. 3.16, p. 80].

Ipotesi dell'orologio molecolare: Ipotesi che il cambiamento molecolare sia lineare con il tempo e costante su diversi taxa e in luoghi diversi. Se è così, allora la differenza di sequenza tra omologhi in diversi taxa può essere usata per stimare il tempo dalla divergenza. [Vedi testo di Avise, pp. 100-109].

Gruppo monofiletico (clade): assemblaggio evolutivo di taxa che include un antenato comune e tutti i suoi discendenti. [Vedi Avise, p. 36].

MtDNA: DNA mitocondriale. Il sequenziamento del mtDNA è una tecnica ampiamente utilizzata in sistematica. La trasmissione clonale, prevalentemente materna, del mt-DNA offre sia opportunità che problemi per l'analisi filogenetica. [Vedi Avise, p. 63].

N e: Dimensione effettiva della popolazione . Molti fattori includono la fluttuazione delle dimensioni della popolazione, il rapporto tra i sessi (ne = (4nm*nF)/(nm+nF), l'età della riproduzione (generazioni sovrapposte), la dispersione spaziale della popolazione (ne = 4 ps 2 d ) e la dimensione della famiglia può influenzare n e. Generalmente, n e sarà inferiore a n (la dimensione della popolazione censita) nelle popolazioni naturali. Se, tuttavia, la distribuzione delle dimensioni delle famiglie è più uniforme di Poisson, allora n e può essere > n. ne è un componente fondamentale di molte formulazioni di genetica di popolazione. Spesso però si trova nel termine 4n m o 4nm (rispettivamente mutazione o migrazione) e quindi non può essere stimato da solo. Vedi Crow e Kimura (1970) per una panoramica Ewens (1982), Harris e Allendorf (1989), Caballero e Hill (1992), e Nunney ed Elam (1994) discutono anche il concetto. Il primer di Hartl (2000) sulla genetica delle popolazioni ha un utile riassunto alle pp. 96-98.

Sostituzione non sinonimo: una sostituzione nucleotidica (mutazione) che si traduce in un diverso amminoacido. Più probabile per i codoni di prima e seconda posizione.

Nucleotidi : gli elementi costitutivi del DNA (e dell'RNA). I nucleotidi del DNA sono costituiti da una base azotata, uno zucchero desossiribosio e un gruppo fosfato.

OTU: Unità tassonomica operativa. Gli esempi includono popolazioni, specie, generi e famiglie. Per le analisi filogenetiche, le OTU saranno taxa terminali (cioè si verificano alle punte dei rami dell'albero).

Outgroup: Taxon filogeneticamente al di fuori del clade di interesse (l'ingroup). Quando si usa un outgroup nell'inferenza filogenetica, si presume implicitamente che l'ingroup sia monofiletico. Il miglior punto di riferimento per determinare la polarità (direzione del cambio di carattere/se un carattere è o non è ancestrale). [Vedi Avise, p. 36 pag. 416 di Sistematica Molecolare, 2a edn.].

Panmixia: Assenza di qualsiasi differenziazione tra sottopopolazioni (a causa di alti livelli di flusso genico, creando effettivamente un'unica grande popolazione senza struttura interna). L'aggettivo è panmittica.

PCR : reazione a catena della polimerasi. Tecnica per amplificare gli acidi nucleici in un termociclatore. Implica l'uso di coppie di primer forward e reverse che iniziano la reazione. La resa finale è di molti ordini di grandezza in più di DNA della sequenza bersaglio rispetto a quella iniziale. Il DNA amplificato risultante può quindi essere visualizzato con coloranti o etichettatura radioattiva o dimensionato con marcatori fluorescenti in un sequenziatore. [Vedi Avise, p. 84, fig. 3.18, pag. 85].

fenotipo : l'espressione esteriore di un genotipo. Questa variazione "visibile" potrebbe essere espressa come colore del mantello in un topo, come l'odore di un composto secondario (menta o salvia), o come la lunghezza di un frammento di DNA su un gel elettroforetico. cfr. genotipo.

filogeografia : Studio dei modelli di differenziazione genetica attraverso i paesaggi, che spesso comportano variazioni intraspecifiche e il confronto dei modelli attraverso una serie di diversi taxa nella stessa regione (biogeografia filogenetica). Pioniere di John Avise.

Reazione a catena della polimerasi: vedere PCR.

Poliploide: possiede più di due serie di cromosomi omologhi. Un percorso comune alla speciazione nelle piante. Recentemente, i ricercatori hanno scoperto un roditore sudamericano poliploide.

Primer : Breve catena polinucleotidica a filamento singolo preesistente a cui possono essere aggiunti nuovi desossiribonucleotidi mediante DNA polimerasi (per 'innescare' l'amplificazione PCR). Il primer si riassocia a un modello di acido nucleico (DNA dell'organismo di interesse) e promuove la copiatura del modello, a partire dal sito del primer. Per amplificare i microsatelliti si usa una coppia di primer forward e reverse:

[agctcagtccctagtcagtact]acacacacacacacacacac[ggtacttcggagctatccgaattccct] In questo esempio i bp in corsivo sono i primer forward e reverse (non dovrebbero differire tra gli individui), mentre la ripetizione 'ac' unitalicizzata è il microsatellite. Correndo avanti e indietro attraverso la ripetizione si possono amplificare alcune copie della regione microsatellite per ordini di grandezza, producendo DNA sufficiente per consentire la visualizzazione del prodotto amplificato su un gel di acrilammide mediante colorazione con bromuro di etidio.
Alcune sequenze di primer possono essere conservate attraverso ampie lacune tassonomiche (ad esempio, tra famiglie), mentre altre possono differire anche tra congeneri.

Sonda: molecole di DNA o RNA a filamento singolo di una specifica sequenza di basi, marcate radioattivamente, immunologicamente o con altri mezzi, utilizzate per rilevare la sequenza di basi complementare mediante ibridazione. Alcuni marcatori genetici (ad esempio i minisatelliti) dipendono da tecniche basate su sonde.

accoppiamento casuale : Un presupposto semplificativo fondamentale per molti modelli di genetica delle popolazioni. Gli accoppiamenti non casuali possono essere assortiti (uccelli di una piuma), disassortitivi (gli opposti si attraggono) o distorti (hotshot). Ad esempio, per l'equilibrio di Hardy-Weinberg, è richiesto l'accoppiamento casuale.

Ricombinazione: scambio di segmenti genici mediante incrocio sui chiasmi (scambio di materiale tra cromatidi non fratelli). Le sezioni scambiate sono generalmente omologhe. La probabilità di ricombinazione aumenta con l'aumentare della distanza fisica.

Sequenziamento: Tecniche molecolari per la deduzione della composizione nucleotidica del DNA. Le due principali alternative sono il sequenziamento Maxam-Gilbert e il sequenziamento Sanger/dideoxy. [Vedi Avise, 1996, Fig. 3.17, p. 83 Russell, 1992, pp. 458-462 Miyamoto e Cracraft, 1991].

Sostituzione silenziosa: mutazione in una regione codificante/espressa del DNA che non produce alcun cambiamento nell'aminoacido codificato (a causa della ridondanza del codice genetico). Conosciuto anche come sostituzione sinonimo.

Ripetizione tandem in sequenza semplice: vedi microsatellite .

Replicazione di slippage: un processo di mutazione per cui una ripetizione semplice in tandem di sequenza (microsatellite) cresce per addizione o sottrazione delle "perline" di unità semplici che compongono la "collana". Una ripetizione dinucleotide AC crescerebbe per addizione o sottrazione di unità AC.

Mutazione graduale: la variazione del microsatellite sembra derivare dallo slittamento nella replicazione, che è più probabile che aggiunga o elimini una singola unità di ripetizione (passi di uno). Di conseguenza, alleli di dimensioni più simili saranno presumibilmente più strettamente correlati. Queste informazioni "filogenetiche" aggiuntive possono essere utilizzate per valutare la differenziazione genetica o la distanza genetica.

Simpatrico: si verifica nella stessa area geografica. cfr. allopatrico.

Sostituzione sinonima: una sostituzione nucleotidica che non determina un amminoacido diverso (ad esempio, qualsiasi codone che inizia con CC codificherà per la prolina, indipendentemente dal codone nella terza posizione). Conosciuto anche come sostituzione "silenziosa". Le sostituzioni sinonime risultano dalla degenerazione (ridondanza) del codice genetico nella posizione del terzo codone. Una sostituzione non sinonima modifica la codifica degli amminoacidi. [Vedi Avise, Fig. 4.2, p. 102].

Taxon (plurale taxa): Gruppo di organismi legati da antenati comuni. I taxa possono variare in scala da popolazioni a regni.

Termociclatore: il 'motore' o macchina PCR, in cui viene eseguita la PCR.

Transizione: una mutazione puntiforme nel DNA in cui la sostituzione avviene con un nucleotide simile. Cioè, una purina (A e G) da una purina o una pirimidina (C o T) da una pirimidina. Le transizioni accadono più spesso delle trasversioni. I diversi tassi di mutazione possono essere incorporati nell'inferenza filogenetica mediante vari schemi di ponderazione. [Vedi pp. 432-438 di Mol. Syst., 2a ed.].

Transversione: una mutazione puntiforme nel DNA in cui la sostituzione avviene con un nucleotide dissimile. Cioè, una purina (A o G) è sostituita da una pirimidina (C o T) o viceversa. cfr. transizione.

Visualizzazione: tecnica per valutare la variazione tra segmenti di DNA (marcatori genetici). I metodi includono la marcatura radioattiva (esposizione di gel alla pellicola a raggi X) e varie colorazioni (bromuro di etidio, colorazioni d'argento, ecc.).

Effetto Wahlund : Riduzione dell'omozigosi (aumento dell'eterozigosi) quando i taxa distinti vengono analizzati congiuntamente o quando si ibridano. Ogni volta che le sottopopolazioni variano nella frequenza dei geni, la popolazione nel suo insieme mostrerà un effetto Wahlund. L'effetto opposto, noto come rottura dell'isolato, si verifica quando le popolazioni divergenti si mescolano. In tal caso, gli incroci mostreranno un aumento dell'eterozigosi rispetto alle aspettative di Hardy-Weinberg.

*Brooks, D.R. e D.A. McLennan. 1991. Filogenesi, ecologia e comportamento. Chicago Univ. Stampa, Chicago.

*Ferraris, J.D. e S.R. Palumbi (a cura di). 1996. Zoologia molecolare: progressi, strategie e protocolli. Wiley-Liss, NY. 580 pagg.

*Gillespie, J. H. 1998. Genetica della popolazione: una guida concisa. The Johns Hopkins University Press, Baltimora, Md. On Reserve ISBN 0-8018-5755-4 $ 19,95

*Hartl, D.L. 2000. A Primer of Population Genetics (3a ed.). Sinauer Associates, Sunderland, MA.

*Hartl, D.L. e A.G. Clark. 1989. Principi di genetica delle popolazioni. Sinauer Associates, Sunderland, MA. [La terza edizione è ora disponibile]

*Hillis, D.M., C. Moritz e B.K. Mable (a cura di). 1996. Sistematica molecolare (2a ed.). Sinauer Associates, Sunderland, MA.
[Ha un glossario utile]

Hoelzel, A.R. e G.A. Dover. 1991. Ecologia genetica molecolare. IRL Press, Oxford U. Press, Oxford
SCI QH 455.H64 1991.

Kendrew, J.C. 1994. L'enciclopedia della biologia molecolare. Blackwell Science, Oxford
CHIAMATA RIF SCI #: QH506 .E53 1994

*Li, W. 1997. Evoluzione molecolare. Sinauer Associates, Sunderland, MA.

*Maddison, W.P. e D.R. Maddison. 1992. MacClade: Analisi della filogenesi e dell'evoluzione del carattere. Sinauer Associates, Sunderland, MA. V. 3.

Martins, E.P. e T.F. Hansen. 1997. Filogenesi e metodo comparativo: un approccio generale per incorporare informazioni filogenetiche nell'analisi di dati interspecifici. Sono. Naz. 149: 646-667.

Rieger, R, A. Michaelis e M.M. Verde. 1991. Glossario di genetica: classica e molecolare, 5a edn. Springer-Verlag, Berlino
RIF SCI CHIAMATA #: QH427.R54 1991

Russell, P.J. Genetics, 3a edizione. Harper, Collins, New York.
Biblioteca UW Science chiamata # QH 430.R87 1992.

*Weir, B.S. 1996. Analisi dei dati genetici II: Metodi per dati genetici di popolazione discreti (2a ed.). Sinauer Assoc., Sunderland, MA.

Caballero, A. e W.G. Hill. 1992. Una nota sulla dimensione effettiva della popolazione consanguinea. Evol. 46: 1969-1972.

*Caswell, H. 1989. Modelli di popolazione a matrice. Sinauer Associates, Sunderland, Mass.

Danchin, E., G. Gonzalez Davila e J.D. Lebreton. 1995. Stima corretta dell'idoneità degli uccelli utilizzando modelli demografici. J Avian Biol. 26: 67-75.

Ewens, W.J. 1982. Sul concetto di dimensione effettiva della popolazione. Teore. Pop. Biol. 21: 373-378.

Freifelder, D.M. 1987. Biologia Molecolare, 2a edn. Boston: Jones e Bartlett
CHIAMATA #: QH 506 .F73 1987

Goldstein, D.B., A.R. Linares, L.L. CavalliSforza e M.W. Feldman. 1995. Una valutazione delle distanze genetiche per l'uso con loci microsatelliti. Genetica 139: 463-471.

Grafen, A. 1982. Come non misurare la fitness inclusiva. Natura 298: 425-426

Harris, R.B. e F.W. Allendorf. 1989. Dimensione della popolazione geneticamente efficace di grandi mammiferi: una valutazione degli estimatori. Conserva. Biol. 3: 181-191.

Hartl, D.L. 2000. A Primer of Population Genetics (3a ed.). Sinauer Associates, Sunderland, MA.

McDonald, D.B. e W.K. Potti. 1997. DNA microsatellite come marcatore genetico a diverse scale. pp. 29-49 In Avian Molecular Evolution and Systematics (D. Mindell, ed.). Stampa accademica, New York.

McGraw, J.B. e H. Caswell. 1996. Stima della fitness individuale dai dati della storia di vita. Sono. Naz. 147: 47-64.

Metz, J.A.J., R.M. Nisbet e S.A.H. Geritz. 1992. Come dovremmo definire 'idoneità' per scenari ecologici generali? ALBERO 7: 198-202

Miyamoto, M.M. e J. Cracraft. 1991. Analisi filogenetica delle sequenze di DNA. Oxford University Press, Oxford.

Nei, M. 1972. Distanza genetica tra le popolazioni. Sono. Naz. 106: 283-292.

Nei, M. 1973. Analisi della diversità genica in popolazioni suddivise. P.N.A.S., USA 70: 3321-3323.

Nei, M. 1977. Statistica F e analisi della diversità genica in popolazioni suddivise. Anna. Ronzio. Genet. 41: 225-233.

Nei, M. 1978. Stima dell'eterozigosi media e della distanza genetica da un piccolo numero di individui. Genetica 76: 379-390.

Nunney, L. e D.R. Elam. 1994. Stima della dimensione effettiva della popolazione delle popolazioni conservate. Conserva. Biol. 8: 175-184.

Pemberton, J.M., Slate, J., Bancroft, DR e Barrett, J.A. (1995). Alleli non amplificanti nei loci microsatelliti: un'avvertenza per studi di parentela e popolazione. Mol. Eco. 4, 49-52.

Queller, DC e K.F. Buona Notte. 1989. Stima della parentela usando marcatori genetici. Evol. 43: 258-275.

Reynolds, J., B.S. Weir e C.C. Cockerham. 1983. Stima del coefficiente di coancestry: base per una distanza genetica a breve termine. Genetica 105: 767-779.

Shriver, M.D., L. Jin, E. Boerwinkle, R. Deka, R.E. Ferrell e R. Chakraborty. 1995. Una nuova misura della distanza genetica per loci ripetuti in tandem altamente polimorfici. Mol. Biol. Evol. 12: 914-920.

Slatkin, M. 1995a. Una misura della suddivisione della popolazione basata sulle frequenze alleliche dei microsatelliti. Genetica 139: 457-462
Modello di mutazione graduale della struttura genetica. CORREZIONE SUCCESSIVA

Slatkin, M. 1995b. Una misura della suddivisione della popolazione basata sulle frequenze alleliche dei microsatelliti (vol. 139, pg. 457, 1995). Genetica 139: 1463

Swofford, D.L. 1996. PAUP: Analisi filogenetica mediante parsimonia (e altri metodi), versione 4.0. Sinauer Associates, Sunderland MA.

Swofford, D.L., G.J. Olsen, P.J. Waddell e D.M. Hillis. 1996. Inferenza filogenetica. Capitolo 11, pp. 407-514 In: Sistematica molecolare, 2a ed. (D.M. Hillis, C. Moritz e B.K. Mable, a cura di). Sinauer Associates, Sunderland, MA.

*Weir, B.S. 1996. Analisi dei dati genetici II: Metodi per dati genetici di popolazione discreti (2a ed.). Sinauer Assoc., Sunderland, MA.

Weir, B.S. e C.C. Cockerham. 1984. Stima F-statistiche per l'analisi della struttura della popolazione. Evol. 38(6): 1358-1370.

Wright, S. 1969. Evoluzione e genetica delle popolazioni, vol. 2. Stampa dell'Università di Chicago, Chicago.

Wright, S. 1978. Evoluzione e genetica delle popolazioni, vol. 4. Stampa dell'Università di Chicago, Chicago.

——————————————————————————————————————————————————————————————————————
Programmi di analisi genetica--Siti web (questi possono cambiare!): L'appendice al capitolo 11 di Hillis et al. (1996) ha un elenco di pacchetti software per computer utili per le analisi filogenetiche.
Calcolatore di assegnazione: Online o scarica. Assegna gli individui alle popolazioni in base ai valori di verosimiglianza. http://www.biology.ualberta.ca/jbrzusto/Doh.html COLLO DI BOTTIGLIA 1.2.02 Windows 25-nov-99 * Utilizza il formato di input GENEPOP
Rilevamento delle recenti riduzioni effettive delle dimensioni della popolazione dalle frequenze dei dati allelici
http://www.ensam.inra.fr/urlb/ Cervo: "un pacchetto basato su Windows per l'analisi della parentela che utilizza un approccio di probabilità. Prendendo i dati dei marcatori co-dominanti in formato testo, CERVUS calcola le frequenze alleliche, esegue simulazioni ed esegue l'analisi della parentela all'interno di un unico framework di facile utilizzo."
Marshall, TC, Slate, J, Kruuk, L e Pemberton, JM (1998) Confidenza statistica per l'inferenza di paternità basata sulla probabilità nelle popolazioni naturali. Mol. Eco. 7: 639-655.
http://helios.bto.ed.ac.uk/evolgen/cervus/cervusregister.html FSTAT versione 2.8 finestre 25-nov-99 * Un programma di Goudet che calcola le statistiche F per (principalmente) dati microsatelliti
http://www.unil.ch/izea/softwares/fstat.html GDA. Windows/PC Esegue varie analisi genetiche di popolazione. Basato in parte su Weir (1996)
http://alleyn.eeb.uconn.edu/gda/ GENECLASS Windows 25-nov-99 * GeneClass è un programma per l'assegnazione e l'esclusione che utilizza marcatori molecolari
(simile al test di assegnazione di Paetkau, ma più diversificato). Di J. Cornuet.
http://www.ensam.inra.fr/urlb/ GENEPOP. Esegue varie analisi di genetica di popolazione. Basato su Raymond e Rousset (1995).
Tramite FTP anonimo da:
ftp.cefe.cnrs-mop.fr/pub/msdos/genepop [DOS] Parentela: "Kinship 1.1 verifica ipotesi di relazioni genealogiche tra coppie di individui utilizzando dati provenienti da marcatori genetici codominanti, a locus singolo (come i microsatelliti del DNA)."
http://www.bioc.rice.edu/

kfg/GSoft.html Migrare: Macintosh "Migrate stima i parametri della popolazione (dimensione effettiva della popolazione e tassi di migrazione) utilizzando dati genetici (allozimi, microsatelliti, dati di sequenza). È uno stimatore di massima verosimiglianza e utilizza un approccio di teoria coalescente che tiene conto della storia delle mutazioni e dell'incertezza della genealogia ." di Peter Beerli
Beerli, P. e J. Felsenstein. 1999. Stima di massima verosimiglianza dei tassi di migrazione e dei numeri effettivi della popolazione in due popolazioni utilizzando un approccio coalescente. Genetica 152:763-773.
http://evolution.genetics.washington.edu/lamarc/migrate.html MISAT. Analisi dei microsatelliti con la massima verosimiglianza http://ib.berkeley.edu/labs/slatkin/rasmus/MISAT.1.0.hqx
misat 1.0 per PowerMac Summer-99 *
Calcola 4Nµ (R. Nielsen) FILIPPO: Pacchetto di inferenza filogenetica (versione 3.5c, ottobre 1996). Suite di programmi software di analisi filogenetica per varie piattaforme (PC, UNIX e Mac/PowerMac). Neighbor-Joining, UPGMA , Fitch-Margoliash e altri metodi di costruzione di alberi. Sviluppato da Joe Felsenstein, Univ. di Lavare.
ftp://evolution.genetics.washington.edu/pub/phylip/. Correlazione 5.05. Macintosh. calcola R ( coefficiente di parentela ). Basato su Queller e Goodnight (1989)
http://www.bioc.rice.edu/Keck2.0/labs/ R NS Calc 2.2: Windows/PC Calcola una versione imparziale di Slatkin’s (1995) R NS . Goodman, SJ 1997. Rst Calc: una raccolta di programmi per computer per il calcolo delle stime della differenziazione genetica dai dati dei microsatelliti e la determinazione del loro significato. Molecular Ecology 6: 881-885.
http://helios.bto.ed.ac.uk/evolgen/rst/rst.html TFPGA (Strumenti per l'analisi genetica delle popolazioni): http://herb.bio.nau.edu/

miller/tfpga.htm Glossari e altre risorse sul web:
Pagine di biologia di Kimball (http://www.ultranet.com/

jkimball/BiologyPages)
Biografia generale. glossario e mini-saggi, con enfasi sulla biologia molecolare e cellulare. Torna all'inizio della pagina


Contenuti

Lewontin è nato a New York City, da genitori discendenti di immigrati ebrei dell'Europa orientale della fine del XIX secolo. Ha frequentato la Forest Hills High School e l'École Libre des Hautes Études a New York. Nel 1951 si laureò all'Harvard College (BS, biologia). Nel 1952, Lewontin conseguì un master in statistica matematica, seguito da un dottorato in zoologia nel 1954,[6] entrambi alla Columbia University, dove fu allievo di Theodosius Dobzhansky.

Ha ricoperto incarichi di facoltà presso la North Carolina State University, l'Università di Rochester e l'Università di Chicago. Nel 1973 Lewontin è stato nominato Alexander Agassiz Professor di Zoologia e Professore di Biologia all'Università di Harvard, mantenendo la carica fino al 1998.

Lavoro nella genetica delle popolazioni Modifica

Lewontin ha lavorato in genetica delle popolazioni sia teorica che sperimentale. Un segno distintivo del suo lavoro è stato l'interesse per le nuove tecnologie. È stato il primo a fare una simulazione al computer del comportamento di un singolo locus genico (il precedente lavoro di simulazione era stato di modelli con più loci). [ citazione necessaria ] Nel 1960 lui e Ken-Ichi Kojima furono i primi genetisti di popolazioni a fornire le equazioni per il cambiamento delle frequenze degli aplotipi con l'interazione della selezione naturale a due loci. [7] Questo ha dato il via a un'ondata di lavori teorici sulla selezione a due locus negli anni '60 e '70. Il loro articolo ha fornito una derivazione teorica degli equilibri attesi e ha anche studiato la dinamica del modello mediante l'iterazione del computer. Lewontin in seguito introdusse la misura D' del linkage disequilibrium. [8] (Ha anche introdotto il termine "linkage disequilibrium", di cui molti genetisti della popolazione non sono stati entusiasti. [9] )

Nel 1966, lui e Jack Hubby pubblicarono un articolo che rivoluzionò la genetica delle popolazioni. [3] Hanno usato l'elettroforesi su gel proteico per esaminare dozzine di loci nel moscerino della frutta Drosophila pseudoobscura, e ha riferito che una grande frazione dei loci era polimorfica e che al locus medio c'era circa il 15% di possibilità che l'individuo fosse eterozigote. (Harry Harris ha riportato risultati simili per gli esseri umani all'incirca nello stesso periodo.) [10] Il lavoro precedente con l'elettroforesi su gel aveva riportato variazioni in singoli loci e non dava alcun senso di quanto fosse comune la variazione.

L'articolo di Lewontin e Hubby ha anche discusso la possibile spiegazione degli alti livelli di variabilità bilanciando la selezione o la mutazione neutra. Sebbene non si impegnassero a sostenere la neutralità, questa fu la prima chiara affermazione della teoria neutrale per i livelli di variabilità all'interno delle specie. L'articolo di Lewontin e Hubby ha avuto un grande impatto: la scoperta di alti livelli di variabilità molecolare ha fornito ai genetisti della popolazione ampio materiale su cui lavorare e ha dato loro accesso alla variazione in singoli loci. Le possibili spiegazioni teoriche di questo polimorfismo dilagante sono diventate il fulcro della maggior parte dei lavori di genetica delle popolazioni da allora in poi. Martin Kreitman avrebbe in seguito condotto un'indagine pionieristica sulla variabilità a livello di popolazione nelle sequenze di DNA mentre un dottorato di ricerca. studente nel laboratorio di Lewontin. [11]

Lavoro sulla diversità genetica umana Modifica

In un documento fondamentale, nel 1972 Lewontin ha identificato che la maggior parte della variazione (80-85%) all'interno delle popolazioni umane si trova all'interno di gruppi geografici locali e le differenze attribuibili ai tradizionali gruppi di "razza" sono una parte minore della variabilità genetica umana (1-15 %). [12] In un articolo del 2003, A.W.F. Edwards ha criticato la conclusione di Lewontin che la razza è un costrutto tassonomico non valido, definendolo errore di Lewontin. Ha sostenuto che la probabilità di errata classificazione razziale di un individuo in base alla variazione in un singolo locus genetico è di circa il 30% e la probabilità di errata classificazione diventa vicina allo zero se si studiano abbastanza loci. [13] La critica di Edwards a sua volta ha raccolto le proprie critiche da biologi come Jonathan Marks, che ha sostenuto che "il punto della teoria della razza era scoprire grandi gruppi di persone che sono principalmente omogenei all'interno ed eterogenei tra gruppi contrastanti. Lewontin's l'analisi mostra che tali gruppi non esistono nella specie umana, e la critica di Edwards non contraddice tale interpretazione." [14]

Nel 1975, quando il libro di E.O. Wilson sociobiologia proposte spiegazioni evolutive per i comportamenti sociali umani, biologi tra cui Lewontin, il suo collega di Harvard Stephen Jay Gould e Ruth Hubbard hanno risposto negativamente. [15]

Lewontin e Gould introdussero il termine pennacchio alla biologia evolutiva, ispirandosi al termine architettonico "pennacchio", in un influente articolo del 1979, "I pennacchi di San Marco e il paradigma panglossiano: una critica del programma adattazionista". I "pennarelli" sono stati descritti come caratteristiche di un organismo che esistono come conseguenza necessaria di altre caratteristiche (forse adattative), ma non migliorano direttamente la forma fisica (e quindi non sono necessariamente adattive). [16] La frequenza relativa dei pennacchi rispetto agli adattamenti continua a suscitare controversie nella biologia evolutiva.

Lewontin è stato uno dei primi sostenitori di una gerarchia di livelli di selezione nel suo articolo "The Units of Selection". Ha avuto una grande influenza sui filosofi della biologia, in particolare William C. Wimsatt (che ha insegnato con Lewontin e Richard Levins all'Università di Chicago), Robert Brandon ed Elisabeth Lloyd (che ha studiato con Lewontin come studenti laureati), Philip Kitcher, Elliott Sober e Sahotra Sarkar. Lewontin ha brevemente sostenuto la natura storica della causalità biologica in "La natura è probabile o capricciosa?". [17]

In "Organismo e ambiente" in Scientia, e in forma più popolare nell'ultimo capitolo di Biologia come ideologia, Lewontin ha sostenuto che mentre il darwinismo tradizionale ha ritratto l'organismo come un destinatario passivo delle influenze ambientali, una corretta comprensione dovrebbe enfatizzare l'organismo come un costruttore attivo del proprio ambiente. Le nicchie non sono dei ricettacoli vuoti preformati in cui vengono inseriti gli organismi, ma sono definiti e creati dagli organismi. Il rapporto organismo-ambiente è reciproco e dialettico. M. W. Feldman e altri [18] hanno sviluppato la concezione di Lewontin in modelli più dettagliati sotto il termine costruzione di nicchia.

Nella visione adattamentista dell'evoluzione, l'organismo è una funzione sia dell'organismo che dell'ambiente, mentre l'ambiente è solo una funzione di se stesso. L'ambiente è visto come autonomo e non modellato dall'organismo. Lewontin invece credeva in una visione costruttivista, in cui l'organismo è una funzione dell'organismo e dell'ambiente, con l'ambiente che è anche una funzione dell'organismo e dell'ambiente. Ciò significa che l'organismo modella l'ambiente come l'ambiente modella l'organismo. L'organismo modella l'ambiente per le generazioni future. [19]

Lewontin è stato a lungo un critico dei tradizionali approcci neo-darwiniani all'adattamento. Nel suo articolo "Adattamento" in italiano Enciclopedia Einaudi, e in una versione modificata per Scientifico americano, ha sottolineato la necessità di fornire una caratterizzazione ingegneristica dell'adattamento separata dalla misurazione del numero di discendenti, piuttosto che assumere semplicemente che organi o organismi siano a ottimali adattativi. [20] Lewontin ha affermato che la sua critica tecnica più generale dell'adattazionismo è nata dal suo riconoscimento che gli errori della sociobiologia riflettono presupposti fondamentalmente errati dell'adattabilità di tutti i tratti in gran parte della sintesi evolutiva moderna.

Lewontin ha accusato i neo-darwinisti di raccontare Storie proprio così quando cercano di mostrare come la selezione naturale spieghi novità come le giraffe dal collo lungo. [21]

Sociobiologia e psicologia evolutiva Edit

Insieme ad altri, come Gould, Lewontin è stato un critico persistente di alcuni temi del neodarwinismo. Nello specifico, ha criticato i sostenitori della sociobiologia e della psicologia evolutiva come Edward O. Wilson e Richard Dawkins, che tentano di spiegare il comportamento animale e le strutture sociali in termini di vantaggio o strategia evolutiva. Lui e altri criticano questo approccio quando applicato agli esseri umani, poiché lo vede come determinismo genetico.Nei suoi scritti, Lewontin suggerisce che è necessaria una visione più sfumata dell'evoluzione, che richiede una comprensione più attenta del contesto dell'intero organismo e dell'ambiente. [22]

Tali preoccupazioni su ciò che considera l'eccessiva semplificazione della genetica hanno portato Lewontin a partecipare frequentemente ai dibattiti e a una vita attiva come intellettuale pubblico. Ha tenuto numerose conferenze per promuovere le sue opinioni sulla biologia e la scienza evoluzionistiche. In libri come Non nei nostri geni (co-autore con Steven Rose e Leon J. Kamin) e numerosi articoli, Lewontin ha messo in dubbio gran parte dell'ereditarietà dichiarata dei tratti comportamentali umani, come l'intelligenza misurata dai test del QI. [ citazione necessaria ]

Alcuni accademici lo hanno criticato per aver rifiutato la sociobiologia per ragioni non scientifiche. Edward Wilson (1995) ha suggerito che le convinzioni politiche di Lewontin hanno influenzato la sua visione scientifica. Robert Trivers descrisse Lewontin come ". un uomo con grandi talenti che spesso li sprecava in sciocchezze, nel pavoneggiarsi e nel mettersi in mostra, in un pensiero politico superficiale e in inutili ruminazioni filosofiche mentre limitava il suo lavoro genetico da ipotesi congeniali alla sua politica". [23] Altri come Kitcher (1985) hanno ribattuto che le critiche di Lewontin alla sociobiologia sono autentiche preoccupazioni scientifiche sulla disciplina. Ha scritto che attaccare le motivazioni di Lewontin equivale a un ad hominem discussione. [ citazione necessaria ] A volte Lewontin si è identificato come marxista e ha affermato che le sue opinioni filosofiche hanno rafforzato il suo lavoro scientifico (Levins e Lewontin 1985).

Agroalimentare Modifica

Lewontin ha scritto sull'economia dell'agrobusiness. Ha sostenuto che il mais ibrido è stato sviluppato e propagato non per la sua qualità superiore, ma perché ha permesso alle società agroalimentari di costringere gli agricoltori ad acquistare nuovi semi ogni anno piuttosto che seminare semi prodotti dal loro precedente raccolto di mais (Lewontin 1982). Lewontin ha testimoniato in una causa senza successo in California, sfidando il finanziamento statale della ricerca per sviluppare raccoglitori automatici di pomodori. Ciò ha favorito i profitti dell'agrobusiness rispetto all'occupazione dei lavoratori agricoli (Lewontin 2000).

Lewontin, R. C. 1982. La ricerca agricola e la penetrazione del capitale. Scienza per il popolo 14 (1): 12-17. http://www.science-for-the-people.org/wp-content/uploads/2015/07/SftPv14n1s.pdf.

Lewontin, R.C. 2000. La maturazione dell'agricoltura capitalista: agricoltore come proletario. Pag. 93-106 in F. Magdoff, J. B. Foster e F. H. Buttel, eds. 2000. Affamato di profitto: la minaccia dell'agroalimentare agli agricoltori, al cibo e all'ambiente. Rassegna mensile Press, NY.

A partire dal 2003, Lewontin è stato Alexander Agassiz Research Professor ad Harvard. Ha lavorato e ha avuto una grande influenza su molti filosofi della biologia, tra cui William C. Wimsatt, Elliott Sober, Philip Kitcher, Elisabeth Lloyd, Peter Godfrey-Smith, Sahotra Sarkar e Robert Brandon, spesso invitandoli a lavorare nel suo laboratorio.

Dal 2013, Lewontin è stata inserita nell'Advisory Council del National Center for Science Education. [24]

A metà del 2015, Lewontin e sua moglie Mary Jane vivono in una fattoria a Brattleboro, nel Vermont. È ateo. [25]


Modelli di distribuzione delle specie: spiegazione e previsione ecologica nello spazio e nel tempo

Jane Elith e John R. Leathwick
vol. 40, 2009

Astratto

I modelli di distribuzione delle specie (SDM) sono strumenti numerici che combinano le osservazioni della presenza o dell'abbondanza delle specie con le stime ambientali. Sono utilizzati per acquisire conoscenze ecologiche ed evolutive e per prevedere le distribuzioni attraverso i paesaggi, . Per saperne di più

Materiali supplementari

Questo supplemento fornisce ulteriori riferimenti per le informazioni nella nostra recensione, seguendo la stessa struttura dell'articolo principale. Abbiamo elencato in modo selettivo i documenti che porteranno a un'utile ampiezza o profondità di altri, illustreranno un particolare concetto o applicazione, o rappresenteranno ambienti diversi, usi del modello o nuovi approcci promettenti. Per saperne di più

Figura 1: La relazione tra specie mappate e dati ambientali (a sinistra), spazio ambientale (al centro) e previsioni mappate da un modello che utilizza solo predittori ambientali (a destra). Nota che.

Figura 2: Dissomiglianze tra i climi del 2000 d.C. e quelli (entro 500 km da un sito target) stimati per il 2100 d.C. utilizzando insiemi multimodello per lo scenario A2 della quarta valutazione dell'IPCC.


Stima delle dimensioni effettive della popolazione dai dati sui marcatori genetici

La dimensione effettiva della popolazione (Ne) è un parametro importante in ecologia, biologia evolutiva e biologia della conservazione. È, tuttavia, notoriamente difficile da stimare, principalmente a causa della natura altamente stocastica dei processi di consanguineità e deriva genetica per i quali il Ne viene solitamente definito e misurato, e per i numerosi fattori (come le scale temporali e spaziali, le forze sistematiche ) confondendo tali processi. Negli ultimi tre decenni sono stati sviluppati molti metodi per stimare le dimensioni effettive della popolazione attuale, passata e antica utilizzando diverse informazioni estratte da alcuni marcatori genetici in un campione di individui. Questo articolo esamina le metodologie proposte per stimare Ne da dati genetici utilizzando informazioni sull'eccesso di eterozigosi, squilibrio di collegamento, cambiamenti temporali nella frequenza degli alleli e modello e quantità di variazione genetica all'interno e tra le popolazioni. Per ciascuna metodologia descrivo principalmente il modello logico e genetico su cui si basa, i dati richiesti e le informazioni utilizzate, l'interpretazione della stima ottenuta, alcuni risultati delle applicazioni a dataset simulati o empirici e gli sviluppi futuri necessari.

Cifre

Efficienza dello stimatore di Watterson

Efficienza dello stimatore di Watterson ? W , stimatore di Tajima ? T e di Ewens...


Quantità di eterozigosi - Biologia

La deriva genetica si riferisce a fluttuazioni casuali nelle frequenze alleliche dovute a eventi casuali (vedi figura 6.4, pag. 142). Le lezioni precedenti si sono tutte occupate di forze evolutive deterministiche (prevedibili) spesso chiamate pressioni lineari. La deriva genetica è una forza stocastica (casuale) che può confondere gli effetti prevedibili della selezione, della mutazione e del flusso genico. Anche se potrebbe sembrare che una forza casuale sia di scarso significato per il "progresso" evolutivo (confronteremo questo termine così pesante più avanti), la deriva genetica è una forza estremamente importante nell'evoluzione. Tuttavia, la sua forza dipende dalle dimensioni della popolazione, come illustrerà un semplice esercizio di lancio della moneta. In dieci lanci potresti facilmente ottenere sette teste in 1000 lanci, tuttavia, non otterresti mai 700 teste con una moneta "fair". Lo stesso tipo di fluttuazione casuale nelle frequenze alleliche può verificarsi in piccole popolazioni: considera un sacchetto pieno di biglie rosse e verdi di uguale frequenza, tira fuori una piccola manciata e la frequenza nella tua mano probabilmente non sarà uguale alla frequenza nella borsa originale. Lascia che quella manciata determini la frequenza in una nuova popolazione che ricresce alla dimensione della popolazione originale. Una seconda piccola manciata sposterà casualmente la frequenza su un'altra frequenza. Se tirassi fuori tutte le biglie nella borsa (= grande popolazione), la frequenza sarebbe mantenuta esattamente nella generazione successiva. La deriva genetica non è una potente forza evolutiva in popolazioni molto grandi che si accoppiano casualmente.

Per illustrare le conseguenze della deriva genetica considereremo cosa succede quando la sola deriva altera le frequenze degli alleli tra molte piccole popolazioni. Per illustrare ciò, dobbiamo comprendere la struttura della popolazione, che descrive come gli individui (o le frequenze alleliche) nelle popolazioni riproduttive variano nel tempo e nello spazio. Questa struttura è determinata dall'effetto combinato di forze deterministiche e stocastiche. Introdurremo l'idea della struttura della popolazione mostrando come la deriva genetica e la consanguineità possono modificare le frequenze dei genotipi nelle popolazioni.

Si consideri una griglia di piccole popolazioni (ad es. stagni in Minnesota), tutte con la stessa piccola dimensione di popolazione e che iniziano tutte al tempo t con p = q= 0,5. Nel tempo ogni popolazione sperimenterà una deriva genetica dovuta al campionamento casuale e le frequenze in ciascuna popolazione divergeranno. La distribuzione delle frequenze cambia nel tempo da una distribuzione stretta (tutti 0,5), a una distribuzione piatta (alcune popolazioni a p = 0,1, alcune a 0,9 e tutte le frequenze intermedie), alla fissazione (p = 1,0) o perdita (p = 0.0) degli alleli in tutte le popolazioni (vedi figura sotto). La fissazione è quando tutti gli alleli nella popolazione sono A, ciò implica necessariamente la perdita dell'allele a ("fissazione" o "perdita" dovrebbe essere usata solo con riferimento a un allele specifico). Se ogni popolazione inizia da p = 0.5, allora alla fine, quando tutte le popolazioni hanno perso la loro variazione, il 50% delle popolazioni sarà fissato per l'allele A e il 50% sarà fissato per l'allele a (quest'ultimo = "perdita" per l'allele Un allele, capito?). Se la frequenza iniziale fosse p = 0,7, allora il 70% delle popolazioni verrebbe fissato per l'allele A (di nuovo, supponendo nessuna selezione, migrazione, mutazione).

Punti principali: 1) la variazione totale non cambia la variazione va dall'interno delle popolazioni (nessuna variazione tra le popolazioni) a tra le popolazioni (nessuna variazione all'interno delle popolazioni). 2) divergenza genetica delle popolazioni del tutto casuale! (nessuna selezione). Ecco perché la deriva genetica può essere una forza importante nell'evoluzione.

All'inizio di questo processo di deriva nella nostra gamma di popolazioni, p = 0,5 e ci sono 2pq = 0,5 = 50% eterozigoti. Quando tutte le popolazioni nell'array hanno fissato o perso l'allele, non possono esserci eterozigoti (cioè 0%). Ciò mostra che la proporzione di eterozigoti diminuisce con il procedere della deriva (questo si verifica anche quando c'è consanguineità che può anche essere pensata come un fenomeno di errore di campionamento). Possiamo quantificare questo processo come segue: la proporzione di eterozigoti nella "prossima" generazione è una funzione della proporzione di eterozigoti nella generazione attuale e del "velocità" con cui procede la deriva: H t+1 = H t [1 - (1/ 2N)] dove H = proporzione di eterozigoti nella popolazione (o nell'array di popolazioni) e N = dimensione della popolazione. Questo può essere esteso a molte generazioni come segue: H t = H 0 [1 - (1/2N)] t dove t si riferisce al numero di generazioni future e 0 si riferisce alla generazione presente (o iniziale). Guardando queste equazioni è chiaro che con popolazioni di piccole dimensioni, l'eterozigosi andrà persa rapidamente (la deriva procederà rapidamente), mentre in grandi popolazioni ci sarà poca perdita di eterozigosi.

Se consideriamo nuovamente la nostra griglia di popolazioni, notiamo che man mano che la deriva procede e ogni demolizione

diventa un po' diverso da ogni altro deme, la variazione tra i demi aumenta. Come la perdita di eterozigosi dovuta alla deriva, l'aumento della variazione tra i demi dipende dalla dimensione della popolazione. Questa variazione può essere descritta come V t = p(1-p)[1 - (1 - 1/2N) t ] . Nota a t=0, V t = 0 perché il termine tra parentesi = 0. Man mano che il numero di generazioni procede, la variazione tra le popolazioni (V t ) aumenta rapidamente se N è piccolo, ma lentamente se N è grande.

Un risultato generale man mano che la deriva procede in piccole popolazioni è una carenza di eterozigoti e, reciprocamente, un eccesso di omozigoti. Questo è anche un risultato comune quando c'è stata consanguineità (= accoppiamento tra parenti). Infatti la deriva genetica e la consanguineità sono fenomeni correlati. La relazione tra le frequenze degli eterozigoti attesi rispetto a quelli osservati ci permette di determinare il coefficiente di consanguineità, F = (He - Ho)/He (pedici e e o significano rispettivamente atteso e osservato).

Un effetto della consanguineità è aumentare la frequenza degli omozigoti (e quindi, necessariamente, diminuire la frequenza degli eterozigoti). Nota: mentre la frequenza dei genotipi cambia con l'inbreeding, le frequenze degli alleli rimangono le stesse (assumendo nessuna selezione, migrazione, mutazione). Fare riferimento alla tabella dei dati presentata a pagina 2 della Lezione 6 per convincersi che quei dati potrebbero essere il risultato di consanguineità: F=(0.343 - 0.14)/0.343 = 0.59. Quando la frequenza dell'allele non è zero, ma c'è una completa assenza di eterozigoti, F = 1. Come esercizio, lavorare sui dati della tabella 5.2, pag.98. Questo illustra la consanguineità alta o bassa?

La variazione genetica è generalmente "persa" per l'azione della deriva genetica. Questo è vero se seguiamo il destino di un demo nel tempo. Si noti, tuttavia, che nella nostra gamma di popolazioni, la variazione è "persa" all'interno dei demi, ma la variazione nel sistema totale è preservata, cioè la frequenza allelica nell'intera metapopolazione non cambia, solo le frequenze genotipiche e alleliche all'interno dei singoli demi ).

La consanguineità ha anche l'effetto di aumentare la varianza tra i singoli demi di una popolazione più ampia. In quanto tali, la deriva e la consanguineità sono forze evolutive strettamente correlate. Ricordiamo che la varianza = 1/N_(X-xi)2 . In una popolazione di accoppiamento casuale con p = 0,4, f(AA) = 0,16, f(Aa) = 0,48, f(aa) = 0,36. Se gli alleli agiscono in modo additivo, gli eterozigoti saranno intermedi e vicini alla media nel fenotipo e contribuiranno poco alla varianza con la consanguineità la maggior parte degli individui è omozigote, e quindi devierebbe dalla media e la varianza sarebbe maggiore. In effetti, l'inbreeding rende la distribuzione dei fenotipi più "bimodale" essenzialmente ridistribuendo gli alleli di tutti e tre i genotipi nei due omozigoti (vedi figura 6.5, pag. 143).

La struttura della popolazione è solitamente quantificata da una semplice statistica nota come Fst. Si tratta dell'indice di "fissazione" risultante dal confronto delle sottopopolazioni con la popolazione totale e viene utilizzato per quantificare la proporzione di variazione genetica che si trova tra le sottopopolazioni all'interno della popolazione totale. Un modo importante di pensare a questo problema è confrontare l'eterozigosi media mediata su tutti i demi con l'eterozigosi che risulterebbe se tutti i demi fossero raggruppati in un'unica grande popolazione. L'eterozigosi è la proporzione di eterozigoti nella popolazione ed è definita come H = 2 p q. Si noti che l'eterozigosi è zero alla "fissazione", il caso in cui esiste un solo allele (p = 0 o 1) e che l'eterozigosi è al massimo quando gli alleli sono ugualmente frequenti (ad esempio, p = q = 0,5). [Per completezza, H = 1- (p 2 + q 2 ) che segue da Hardy-Weinberg sopra. Nel caso di più di due alleli, non possiamo usare solo p e q, quindi la seguente espressione per l'eterozigosi funziona più in generale: H = 1 - _x i2 dove xi è la frequenza dell'allele "ith", e la somma è attraverso tutti io alleli. L'espressione 1 - (p 2 + q 2 ) è identica a 1 - _x i2 quando ci sono solo due alleli].

Nel nostro esempio di metapopolazione sopra, a sinistra tutti i demi hanno p = 0,5 e anche la frequenza allelica per l'intero array è p = 0,5. Puoi subito vedere che non c'è alcuna differenziazione tra i demi. Per quantificare questo usiamo Fst che viene calcolato come Fst = (Ht - significa Hs) / Ht , dove Ht = 2 (pool p) (pool q) [nota che pool q = (1-pool p)] e significa Hs = la media dei valori di H per ciascuno dei singoli demi (cioè, 2 pq per ciascun deme, mediati su tutti i demi). Per la metapopolazione di sinistra Ht = 2(0,5)(0,5) = 0,5 e anche Hs medio = 0,5. Quindi, Fst = (0,5 - 0,5) / 0,5 = 0,0. Cosa significa questo? In inglese questo dice che nessuna delle variazioni in questo sistema di demi si trova tra i demi, la struttura della popolazione è zero. Poiché c'è variazione (cioè, p _ 0) tutta la variazione si trova all'interno dei demi.

Consideriamo ora il sistema di metapopolazione in alto a destra. La frequenza dell'allele aggregato è 0,5 perché metà dei demi sono fissati per l'allele A (p = 1,0) e metà sono fissati per l'allele a (p = 0,0). Quindi il valore Ht è 2 (p aggregato) (q aggregato) = 2(0,5)(0,5) = 0,5. Il valore m e an Hs è molto diverso. Ogni demo ha un'eterozigosi pari a zero (po q è zero in tutti i demi), quindi il valore medio di Hs è 0,0. Quindi, per la metapopolazione a destra, Fst = (0,5 - 0,0) / 0,5 = 1,0. In inglese questo significa che tutto (100%) della variazione nel sistema si trova tra i demi. Per definizione, quindi, nessuna delle variazioni si trova all'interno dei demi, che conosciamo perché i piccoli cerchi sono pieni o vuoti. Ormai dovrebbe essere evidente che in Fst i valori possono variare tra i due estremi di zero e uno che abbiamo appena illustrato. Con il procedere della deriva genetica, i valori di Fst aumenteranno, ma l'equilibrio tra la deriva e le "pressioni lineari" determinerà quale equilibrio raggiungerà Fst (lezione successiva).

Un'ulteriore precisazione: la "velocità" o "intensità" della deriva genetica è in realtà determinata dalla dimensione effettiva della popolazione (Ne) . Questo può differire dalla dimensione totale della popolazione (N) se alcuni individui non si riproducono. Due esempi in cui Ne differisce da N sono casi di diverso sistema di accoppiamento e fluttuazioni temporali nella dimensione della popolazione. Quando il numero di maschi riproduttori (Nm) _ numero di femmine riproduttrici (Nf), la dimensione effettiva della popolazione può essere molto diversa dalla dimensione effettiva della popolazione. La relazione è: Ne = 4NmNf/(Nm + Nf) . Se Nm = Nf = N/2, allora Ne = N. Ma se un singolo maschio esegue tutto l'accoppiamento (approssimato negli elefanti marini) allora Ne = 4 (perché Nf/(1+Nf) è circa = 1). Quindi la genetica della popolazione di elefanti marini e gallo forcello sarà molto diversa da quella di grandi popolazioni di insetti.

Con i colli di bottiglia della popolazione in cui la dimensione della popolazione scende a un numero ridotto in una generazione, la dimensione effettiva della popolazione non è solo la media di N per ogni generazione. Per stimare il Ne, si calcola la dimensione media armonica della popolazione come segue:

1/Ne = 1/t_1/Nt dove t = il numero di generazioni e Nt = la dimensione della popolazione ad ogni generazione. Quindi con dimensioni della popolazione di 100, 100, 20, 100 la media aritmetica = 80 ma 1/Ne = 1/4(1/100 + 1/100 + 1/20 + 1/100) = 1/4(0.08) = 0,02, quindi Ne = 1/0,02 = 50 . Quindi la dimensione della popolazione più piccola ha un effetto sproporzionato sulla dimensione effettiva della popolazione. Questa è una questione molto importante negli sforzi di conservazione delle specie in via di estinzione.

La deriva tenderà a ridurre l'eterozigosi (per i nostri scopi equivale alla proporzione di eterozigoti), la mutazione introdurrà nuovi alleli che serviranno ad aumentare l'eterozigosi. Questo fornisce un altro esempio di "lotta" tra forze evolutive opposte. Quando il tasso di mutazione è vicino al reciproco della dimensione della popolazione, l'eterozigosi sarà alta (cioè, esisterà una notevole quantità di variazione nella popolazione). L'"equilibrio" di questo equilibrio può essere descritto da un'equazione per la frequenza di equilibrio degli eterozigoti:

H Å Inserire Ne e u per determinare l'equilibrio: quando Ne = 1/u, H = 0.8 quando u>1/Ne, l'eterozigosi sarà maggiore quando u<1/Ne l'eterozigosi sarà inferiore.

Il flusso genico può contrastare la perdita di eterozigosi dovuta alla deriva così come la divergenza casuale delle frequenze alleliche tra le popolazioni. L'equilibrio tra queste due forze opposte può essere descritto da un'equazione per la varianza di equilibrio tra le popolazioni

V (tra i pop.) Å . All'aumentare di m, la varianza diminuisce (omogeneizzazione più rapida) all'aumentare di N e, la varianza diminuisce (la deriva agisce più lentamente con N e maggiore). La conclusione principale è che ci vuole pochissimo flusso genico per mantenere due "popolazioni" omogenee, appena un migrante riproduttivo tra popolazioni per generazione! Vedere la figura 5.13, pag. 128.

Sono stati sviluppati diversi metodi per stimare i tassi di migrazione da modelli permanenti di variazione di frequenza allelica. Ciò si basa sul fatto che i valori Fst sono il risultato di un "equilibrio" tra flusso genico e deriva. Si può calcolare Fst da marcatori molecolari e, se è disponibile una stima della dimensione effettiva della popolazione, la migrazione può essere stimata dalla seguente relazione: Fst & Aring 1/(4N e m + 1 ). Riorganizzando la formula e inserendo i valori di prova, puoi vedere che valori bassi per m danno come risultato valori alti per Fst e valori alti per m danno valori bassi per Fst. Ciò deriva dall'effetto omogeneizzante del flusso genico sulla variazione della frequenza allelica tra le popolazioni.


La perdita dell'eterozigosi dei geni oncosoppressori si verifica per ricombinazione mitotica o mis-segregazione cromosomica

In una cellula somatica che contiene un allele mutante e uno normale di un gene oncosoppressore, come viene perso o inattivato l'allele normale? Cioè, quali meccanismi possono provocare perdita di eterozigosi (LOH) dell'allele normale? Le mutazioni puntiformi sono una causa improbabile perché tali mutazioni che si verificano nell'allele normale di solito vengono riparate tranne che nelle cellule difettose in alcuni sistemi di riparazione del DNA (Capitolo 12).

Un meccanismo comune per LOH coinvolge missegregazione dei cromosomi recanti il ​​gene oncosoppressore eterozigote durante la mitosi. In questo processo, indicato anche come non disgiunzione, una cellula figlia eredita solo un cromosoma normale (e probabilmente muore), mentre l'altra ne eredita tre, l'altro cromosoma normale e due che portano l'allele mutante. Tale mis-segregazione è causata dal fallimento di un checkpoint mitotico, che normalmente impedirebbe a una cellula in metafase con un fuso mitotico anomalo di completare la mitosi (vedi Figura 13-34). Spesso si verifica la successiva perdita di un cromosoma, ripristinando il 2n complemento se il cromosoma normale viene perso, la cellula risultante conterrà due copie del cromosoma “mutante” (Figura 24-13a).

Figura 24-13

Perdita di eterozigosi (LOH) dei geni oncosoppressori. Una cellula contenente un allele normale e uno mutante di un gene oncosoppressore è generalmente fenotipicamente normale. (a) Se la formazione del fuso mitotico è difettosa, allora i cromosomi duplicati (altro.)

Un altro meccanismo probabile per LOH è ricombinazione mitotica tra un cromatide che porta l'allele wild-type e un cromatide omologo che porta un allele mutante. Come illustrato nella Figura 24-13b, i prodotti di tale ricombinazione sono due cromatidi normali e due cromatidi mutanti. La successiva segregazione cromosomica può generare tre tipi di cellule figlie: una omozigote per l'allele mutante soppressore del tumore, una omozigote per l'allele normale e una come la cellula parentale, eterozigote per l'allele mutante.


File aggiuntivo 1.

Questo file è un foglio di calcolo excel contenente tutte le tabelle supplementari. Tabella S1 - Saccharomyces cerevisiae ceppi utilizzati nel nostro esperimento di validazione. Tabella S2 - Risultati dell'esecuzione di nPhase sul nostro set di dati di convalida utilizzando i parametri ottimali identificati. Tabella S3 - Metriche delle prestazioni dell'esecuzione di nPhase su quel set di dati di convalida.

File aggiuntivo 2.

Questo file è un documento word contenente tutte le cifre supplementari. Fig. S1 Risultati grezzi di nPhase per i diversi poliploidi simulati nel set di dati di convalida. Fig. S2 Livelli di copertura degli aplotig chimerici. Fig. S3 Livelli di copertura di tutti gli aplotig nel pulito Brettanomyces bruxellensis risultati graduali. Fig. S4 Distribuzione di frequenza degli alleli nei cluster di lettura haplotig per il clean Brettanomyces bruxellensis risultati graduali. Fig. S5 nRisultati della fase di fase per i 5 geni più lunghi nel Solanum tuberoso annotazione. Fig. S6 Passi di pre-elaborazione di lunga lettura che li riducono a sequenze di posizioni variabili. Fig. S7 Diversi parametri utilizzati in nPhase. Fig. S8 Effetti sulla precisione dell'esecuzione di nPhase utilizzando diverse combinazioni di parametri. Fig. S9 Effetti sulla contiguità dell'esecuzione di nPhase utilizzando diverse combinazioni di parametri. Fig. S10 Effetti della ploidia sulla scelta ottimale del parametro ID. Fig. S11 Effetto della copertura su accuratezza e contiguità. Fig. S12 Effetti dell'inclusione di letture divise su accuratezza e contiguità.


Guarda il video: La quantità di moto e la sua conservazione lezione di fisica (Giugno 2022).